ID: 918856842

View in Genome Browser
Species Human (GRCh38)
Location 1:189766413-189766435
Sequence GCTTATGTATAAGAAAGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918856842_918856844 11 Left 918856842 1:189766413-189766435 CCTATACTTTCTTATACATAAGC No data
Right 918856844 1:189766447-189766469 AGCCAGAAGAAATGCTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918856842 Original CRISPR GCTTATGTATAAGAAAGTAT AGG (reversed) Intergenic
No off target data available for this crispr