ID: 918870554

View in Genome Browser
Species Human (GRCh38)
Location 1:189968500-189968522
Sequence ACCTTGGCTGGCTGTGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918870554_918870561 11 Left 918870554 1:189968500-189968522 CCTCTGACACAGCCAGCCAAGGT No data
Right 918870561 1:189968534-189968556 TATAATCCTCTGCCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918870554 Original CRISPR ACCTTGGCTGGCTGTGTCAG AGG (reversed) Intergenic
No off target data available for this crispr