ID: 918877515

View in Genome Browser
Species Human (GRCh38)
Location 1:190067912-190067934
Sequence GGCCAAACCCACAATCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918877512_918877515 23 Left 918877512 1:190067866-190067888 CCTTAGTTAACATCATTTTCTCT No data
Right 918877515 1:190067912-190067934 GGCCAAACCCACAATCACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918877515 Original CRISPR GGCCAAACCCACAATCACAT GGG Intergenic
No off target data available for this crispr