ID: 918881148

View in Genome Browser
Species Human (GRCh38)
Location 1:190122928-190122950
Sequence CCTCAATAGCAGACAGTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918881143_918881148 21 Left 918881143 1:190122884-190122906 CCGGCTACTGAGATTATAAAGAT 0: 1
1: 0
2: 3
3: 25
4: 169
Right 918881148 1:190122928-190122950 CCTCAATAGCAGACAGTCTAGGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918881148 Original CRISPR CCTCAATAGCAGACAGTCTA GGG Intronic
908170955 1:61504235-61504257 CCTTAATTGCAGAAAGTTTAGGG - Intergenic
908361716 1:63374766-63374788 CCTGCATAGCAGACATTTTAGGG - Intronic
908607912 1:65820648-65820670 CCTTAATAGCAGTGAGTCAATGG + Intronic
908651929 1:66343247-66343269 CCTCAATGTCAGAAAATCTATGG + Intronic
912385014 1:109267153-109267175 CCACAAAGGCAGACAGTCTGGGG + Intronic
914713210 1:150233975-150233997 CCAAATTAGCAGACAGTCTCAGG - Intronic
917643820 1:177009707-177009729 CCTCCAGAGCAGGCAGTGTAAGG + Intronic
918881148 1:190122928-190122950 CCTCAATAGCAGACAGTCTAGGG + Intronic
920666247 1:207964637-207964659 CCTCCTTAGCAGACCGTCTTGGG - Intergenic
1064621241 10:17219868-17219890 CATCAATAGGAGACTGGCTAAGG + Intergenic
1069294262 10:66824655-66824677 CTTCAAAAGCAGACAGTATGTGG + Intronic
1069735200 10:70649431-70649453 CCTCAATAGCAGACCGAGTGGGG - Intergenic
1070560066 10:77559482-77559504 CCTCACTAGTAGAAAGGCTAAGG + Intronic
1073815152 10:107198214-107198236 TCACAATAGCAGTCAATCTATGG - Intergenic
1077831922 11:5882161-5882183 CCACAGTAGCAGACAGTGTATGG - Intronic
1087210635 11:95443413-95443435 CTTCAATAGCAAATAGTCCAAGG - Intergenic
1088171838 11:107007037-107007059 CTTGAATATAAGACAGTCTACGG - Intronic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089346166 11:117793060-117793082 CCTCAGTAGCAGCCAGTCATTGG - Intronic
1089921879 11:122216779-122216801 TCCCAGTAGCAGACAGTATAAGG + Intergenic
1091322026 11:134658458-134658480 CCTCAATGCCAAACAGTATAGGG - Intergenic
1092599771 12:10047707-10047729 ACTCAATAGGCGACAGTTTAGGG - Intronic
1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG + Intergenic
1100122339 12:91383422-91383444 ACTCAATAGCTGACAGGCTCAGG - Intergenic
1101179040 12:102190549-102190571 CCTCAAGAGCTGACTGTTTATGG - Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1103497300 12:121372980-121373002 CCTCAAGAGTAGGCAGACTAGGG + Intronic
1111243923 13:85509770-85509792 ACGCAATAGCAGACAGTGGAAGG + Intergenic
1118576259 14:67243925-67243947 CCTAACTAGCAGTCAGACTACGG - Intronic
1120328644 14:83059392-83059414 CCTAAATAGAAGATACTCTATGG + Intergenic
1122310290 14:100789984-100790006 CCTCCCTAGCAGACAGTCAAGGG - Intergenic
1123833351 15:24164301-24164323 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123840079 15:24239380-24239402 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123853023 15:24379895-24379917 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123868981 15:24552463-24552485 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1126142227 15:45448169-45448191 CCTCAGGAGCAGACAGCCTGGGG - Intronic
1135287922 16:21210057-21210079 CCTGATTAGCAGACAGCCTTTGG - Intronic
1138901744 16:61279033-61279055 CCTAAATAGCAATCAGTCTTTGG - Intergenic
1145283651 17:21487517-21487539 CCTGAAGAGCAGCCAGTCTGCGG + Intergenic
1145393798 17:22477982-22478004 CCTGAAGAGCAGCCAGTCTGTGG - Intergenic
1153868194 18:9292506-9292528 CCTCTAAAGCACAAAGTCTAGGG - Intergenic
1156583874 18:38410204-38410226 ACTCAAAAGCCCACAGTCTAAGG - Intergenic
1158525386 18:58208599-58208621 CCTCATTAGAAAACTGTCTAAGG - Intronic
926775035 2:16413629-16413651 CCTCATTAGCAGACAATGTTTGG + Intergenic
928877561 2:36057962-36057984 CTTCAAAATCAGATAGTCTATGG + Intergenic
929801257 2:45105101-45105123 CCTAAATTTCAGGCAGTCTAGGG - Intergenic
930742869 2:54850387-54850409 CCTAAATAACAGACATTCAAAGG + Intronic
931206339 2:60149298-60149320 CCTCAACAGCAGGCAGTCTCAGG + Intergenic
932988569 2:76758689-76758711 CCTTAATAGCATACACTCTATGG - Intronic
935414106 2:102797304-102797326 GCTCTATAGAAAACAGTCTAAGG - Intronic
936795979 2:116204477-116204499 CCTCAATAGCAGACAGCAATGGG - Intergenic
938139938 2:128787154-128787176 CATCAACACCAGACAGTCCATGG - Intergenic
942395214 2:175539903-175539925 CCCCAATGGTAGACAGTCTCTGG + Intergenic
944178591 2:196862071-196862093 GCTCACTAGCAGTCAGTTTAAGG - Intronic
945006043 2:205407729-205407751 CTTCAATGGAAGACAGTCTTTGG - Intronic
947952217 2:234158151-234158173 CCTCCATGACTGACAGTCTAGGG + Intergenic
1168979846 20:1995113-1995135 AGTCAATAGCAGACAGTTTGTGG + Intergenic
1169968036 20:11238810-11238832 CCTCAAGAGCTTACATTCTATGG + Intergenic
1170750583 20:19141143-19141165 CCTCAAGAACAGACAGTTGAGGG + Intergenic
1171413622 20:24962711-24962733 CATCAAGAGCAGATGGTCTAAGG + Intergenic
1179334552 21:40438130-40438152 CCTCAAGGTCACACAGTCTATGG - Intronic
1181844174 22:25693287-25693309 CCTCAGCAGCAGGCAGTCCAAGG + Intronic
1182892561 22:33831243-33831265 GCTCATTAGCAGAGATTCTAAGG + Intronic
1182919020 22:34062488-34062510 CCTAAACAGCAGCCAATCTAAGG - Intergenic
949575691 3:5337187-5337209 CCTTAATAAGAGACTGTCTAAGG - Intergenic
950772153 3:15320794-15320816 TCTCAAAAGAAGACAGGCTATGG - Intronic
959164235 3:102757320-102757342 GCTCAAAAGCAGGCATTCTATGG + Intergenic
959192290 3:103130173-103130195 CCTCAATACAAGATATTCTAAGG - Intergenic
962467783 3:135676272-135676294 CCTCAATAGCAGAATGGATATGG - Intergenic
976907292 4:90254751-90254773 TCTCAATAAGTGACAGTCTATGG - Intronic
978371647 4:108035466-108035488 CCTCATTAGCAGAAAGCTTAAGG + Intergenic
984625139 4:181998581-181998603 CCTCAATTGCAGAGGTTCTAGGG + Intergenic
995868769 5:116722876-116722898 CCTCCACAGCAGCCAGTCTAGGG + Intergenic
997275081 5:132578953-132578975 GATCAATAGCAGACAGGCAAAGG - Intronic
1003510175 6:6773033-6773055 CCTCAACTGGAGACACTCTAGGG - Intergenic
1008327003 6:50194094-50194116 GCTCAGTAGCAGACACTGTATGG - Intergenic
1008864956 6:56199193-56199215 CCTCAACAGCAGAAAGTCCTTGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014751256 6:125259123-125259145 CCTCAGCAGAAAACAGTCTAAGG - Intronic
1014878451 6:126690754-126690776 CCTCAATAGCAGATAGTTGCGGG - Intergenic
1015867228 6:137739711-137739733 CCTCCCTAGCAGACTGTCTGAGG - Intergenic
1016268933 6:142265785-142265807 CCTCAATTGCAGGCAGTCAGAGG + Intergenic
1036635581 8:10547872-10547894 CCTCAGAAGCCGACACTCTAGGG + Intronic
1037167836 8:15852692-15852714 CCTGAATAGCAGACAGCCGTAGG + Intergenic
1039628878 8:39086813-39086835 CCTGAATAGCATTTAGTCTAGGG + Intronic
1042996505 8:74705502-74705524 CCTCAAAAGGAAACAGTCTGGGG - Intronic
1043152268 8:76732747-76732769 CCTCAATAGCATACCTTCGAAGG + Intronic
1046079020 8:109347934-109347956 CCTGCATATCAGACAGGCTATGG - Intergenic
1050895511 9:10881268-10881290 ACTGAATTGCAGACAGTCCAAGG + Intergenic
1051851326 9:21512320-21512342 CTTCAAAAGCGGACACTCTAAGG - Intergenic
1055878240 9:80968722-80968744 TCTCCATAGCAGCCAGTCTGGGG + Intergenic
1059641118 9:116218049-116218071 CCTGAATACCAAACATTCTATGG - Intronic
1061877105 9:133549677-133549699 CATCAAGAGCAGACAGGCCAAGG - Intronic
1185468028 X:367089-367111 CCCCATTAACAGACACTCTACGG + Intronic
1187235717 X:17465153-17465175 CCACAATTGCAGTCACTCTAAGG - Intronic
1199032865 X:143021643-143021665 CCTTAAAAGCAAACATTCTAAGG - Intergenic
1201902280 Y:19055965-19055987 CATCAACAGCAGACAGTCCATGG + Intergenic