ID: 918882049

View in Genome Browser
Species Human (GRCh38)
Location 1:190137472-190137494
Sequence CATTATAGACAAGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918882045_918882049 -6 Left 918882045 1:190137455-190137477 CCTGAAAAAATGCTTCGCATTAT 0: 1
1: 0
2: 2
3: 20
4: 204
Right 918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 168
918882044_918882049 19 Left 918882044 1:190137430-190137452 CCAAAGTTTAAAAAAAAAAAAAA 0: 4
1: 143
2: 1210
3: 7686
4: 51310
Right 918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918882049 Original CRISPR CATTATAGACAAGAGGTGGA GGG Intronic
903940695 1:26928984-26929006 CATAACAGCCAAAAGGTGGAAGG + Intronic
904508463 1:30979748-30979770 TATGATAGACTAGAGGTGGTAGG + Intronic
905333143 1:37222694-37222716 CAAAATAGCCAAGAGGTGGAAGG + Intergenic
905364691 1:37443918-37443940 CATTATAGAAAAAAGCTGGCTGG + Intergenic
908171168 1:61506071-61506093 CATCTTATAAAAGAGGTGGAAGG + Intergenic
909831206 1:80192420-80192442 CATTATATCCAAGTGGTTGAAGG - Intergenic
912637332 1:111309563-111309585 CATTACAGGCAAGGAGTGGAGGG + Intronic
917171211 1:172176877-172176899 TATTATAGAAAAGAGGTTGGAGG + Intronic
918281709 1:183012562-183012584 CACCAAAGACAAGAGGTGAAAGG + Intergenic
918882049 1:190137472-190137494 CATTATAGACAAGAGGTGGAGGG + Intronic
918997626 1:191782452-191782474 CATTATAGGCTAGAGGTTGCAGG + Intergenic
920394614 1:205635206-205635228 CATTACAGACATGAAGTGAAAGG - Intergenic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
923165282 1:231355694-231355716 CAGCATAGATAAGAGGGGGAAGG + Intergenic
924939501 1:248803032-248803054 CATCAGAGACAAGAAGAGGAAGG - Intergenic
924939514 1:248803114-248803136 CATCAGAGACAAGAAGAGGAAGG - Intergenic
924939602 1:248803729-248803751 CATCAGAGACAAGAAGAGGAAGG - Intergenic
1062817655 10:512617-512639 CATTATAGAAAGGAGCTGGCCGG + Intronic
1063499712 10:6542438-6542460 GATTTTAGACAAGAGCTGGTGGG + Intronic
1064625736 10:17259539-17259561 CATGATAGAGAAGAGGTGTTTGG + Intergenic
1064996618 10:21301939-21301961 TTTTATAGCAAAGAGGTGGAGGG - Intergenic
1065054058 10:21825448-21825470 CACAGTAGCCAAGAGGTGGAAGG - Intronic
1068044365 10:51867404-51867426 CAGTGTAGAGAAGAGATGGAAGG + Intronic
1069721296 10:70551201-70551223 CATTAGAGAGAAGGGGTGGTAGG - Intronic
1070401414 10:76056461-76056483 CACTATAGACAGCAGGTTGATGG - Intronic
1072177378 10:92941345-92941367 CACAATAGTCAAAAGGTGGAAGG - Intronic
1072547290 10:96449475-96449497 CCTTATCAACAAGAGATGGAAGG + Intronic
1074789835 10:116875754-116875776 CATTATAGACAAGAGTGGATGGG + Intronic
1074827712 10:117226734-117226756 GAGGAGAGACAAGAGGTGGATGG + Intergenic
1080378094 11:31738011-31738033 CATAATAGCCAAGAGGTGAGAGG + Intronic
1080988058 11:37494736-37494758 CATCATAAACAAGAAGGGGAAGG + Intergenic
1085938562 11:81180211-81180233 CATGCTAAACAAGAGGTAGAAGG - Intergenic
1086700301 11:89894212-89894234 GATTATATACAAGATGAGGATGG + Intergenic
1086705869 11:89950314-89950336 GATTATATACAAGATGAGGATGG - Intergenic
1089651426 11:119916311-119916333 AATGGTAGACAAGAGATGGATGG + Intergenic
1090259532 11:125308640-125308662 CATAATAACCAAGAGCTGGAAGG + Intronic
1090519442 11:127462478-127462500 TAGGATAGAGAAGAGGTGGAAGG - Intergenic
1090732281 11:129582159-129582181 CACAAAAGACAAGAGGTGGCAGG - Intergenic
1092973973 12:13726200-13726222 CATAATAGCCTAGAGGTGAAGGG + Intronic
1093070220 12:14700753-14700775 CAATGTAGCCAAGAGGTGTAGGG + Intergenic
1094212972 12:27911478-27911500 GATTATAGTCTAGAGGTGGAGGG - Intergenic
1098697614 12:73579596-73579618 CATTTTATACAAGATGTGTATGG + Intergenic
1100882269 12:99032074-99032096 CAACATAGCAAAGAGGTGGAGGG + Intronic
1104654791 12:130566301-130566323 CCCTCTAGACAAGAGGTGCAAGG + Intronic
1105412386 13:20181659-20181681 CACAACAGCCAAGAGGTGGAAGG - Intergenic
1109542336 13:63795492-63795514 CTTTTTAAACAAGAGGTGGGTGG - Intergenic
1109901269 13:68775435-68775457 CTTTATAGTCAAGAGGTTTAAGG - Intergenic
1111653343 13:91121467-91121489 CATTATAGACAAAGGCTAGAAGG - Intergenic
1112814423 13:103254872-103254894 CATGATAGACCAGAGGTTGAAGG - Intergenic
1115205471 14:30898961-30898983 CATTTTACACATGAGGTTGAAGG - Intronic
1116019958 14:39448349-39448371 CTTTATAGACAAGATTAGGAGGG - Intergenic
1117892446 14:60440741-60440763 GATTAAATCCAAGAGGTGGATGG - Intronic
1121180024 14:91921992-91922014 CATTTTAGAGAATATGTGGAAGG - Intronic
1121278241 14:92682181-92682203 CAGTATAGAAAAGAGATGGCTGG - Intronic
1121736938 14:96225324-96225346 CTCTATAGCAAAGAGGTGGAAGG - Intronic
1126959133 15:53970460-53970482 CACAATAGCCAAGAGGTAGAAGG - Intergenic
1129637995 15:77342879-77342901 TATAATAGCTAAGAGGTGGAAGG - Intronic
1133979725 16:10624188-10624210 CATTATTTAAAAGAGGTGGTGGG - Intergenic
1135866015 16:26102646-26102668 CATTATACAAGAGAGGTGGCAGG - Intronic
1139256373 16:65546796-65546818 AATGATAGAAATGAGGTGGAGGG + Intergenic
1139915977 16:70428729-70428751 CACTGTAGAGAAGAGGAGGAAGG - Intronic
1141026025 16:80548991-80549013 CACTATAGACAAGATGTTCAGGG + Intronic
1141735493 16:85849606-85849628 CAGTAGAGGCAAGAGGTGCAGGG - Intergenic
1143843590 17:9754761-9754783 CATTATAAACAGGAGATGTATGG + Intergenic
1144424947 17:15132919-15132941 GATTATAGAAAAGAGGTAGAGGG + Intergenic
1145732654 17:27203201-27203223 AATTAGAAACAAGAGGTGGGCGG + Intergenic
1146235396 17:31155491-31155513 CATTATTGACAAGAAGTCTAGGG + Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1149040591 17:52183828-52183850 CAATAGGGACCAGAGGTGGAGGG - Intergenic
1152642490 17:81454990-81455012 CAGTATAGCCAAGTGGGGGATGG + Intronic
1153354061 18:4116288-4116310 CATTATAGTCAAAATGTAGAAGG - Intronic
1153723680 18:7934195-7934217 CATTCTTTACAAAAGGTGGATGG - Intronic
1158406219 18:57161917-57161939 GGGTATAGACAAGAGATGGAGGG + Intergenic
1159058810 18:63493275-63493297 CATTATGGAAAAGAGGAGGGGGG - Intronic
1160169115 18:76538316-76538338 CATAATAGCCGAAAGGTGGAAGG - Intergenic
1162820074 19:13217573-13217595 CACTGAGGACAAGAGGTGGAGGG + Intronic
1165055232 19:33172088-33172110 GATTATAGGGAAGAGGAGGAGGG - Intronic
1168180474 19:54659294-54659316 TAATATAGACAACAGGTTGATGG + Intronic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
926674479 2:15609242-15609264 GATTATAGACAAAAGTTAGAGGG + Intronic
927149852 2:20189237-20189259 CAGTATAAAGAACAGGTGGAGGG - Intergenic
930182740 2:48380518-48380540 CACAATAGCCAAAAGGTGGAAGG + Intergenic
930497174 2:52160502-52160524 CACTATAGCCAAGATTTGGAAGG - Intergenic
934581002 2:95438115-95438137 GATTATATACAAGATGAGGATGG - Intergenic
934598448 2:95638599-95638621 GATTATATACAAGATGAGGATGG + Intergenic
938110328 2:128560004-128560026 GGTTTTGGACAAGAGGTGGAAGG + Intergenic
938982810 2:136542635-136542657 CGTTCTAGACAGCAGGTGGAAGG + Intergenic
939433431 2:142141453-142141475 CATGGTGGACAAGAGGAGGAAGG + Intergenic
940365827 2:152847645-152847667 CTTTAGAGACCAGAAGTGGAAGG - Intergenic
942674253 2:178411020-178411042 CACAATAGCCAAAAGGTGGAAGG + Intergenic
943313798 2:186360422-186360444 GATTAAAGACAAGATGGGGAAGG + Intergenic
943351471 2:186801797-186801819 CTTAATAGACAAAAGCTGGAAGG - Intergenic
943822046 2:192337370-192337392 CCTTAGAGCCAAGAGGTGCATGG + Intergenic
944487796 2:200224948-200224970 CCTTATATAGAAGAGGAGGACGG - Intergenic
948319986 2:237061416-237061438 GATTATAGACTAGGGGTGGTGGG - Intergenic
948981944 2:241498942-241498964 CCTTCTAGACAGGACGTGGAGGG - Intronic
1172461025 20:35118803-35118825 CCTTATGGACAAGATATGGAGGG - Intronic
1172471104 20:35196921-35196943 AATTATAAACAACAGGGGGAAGG + Intergenic
1178261298 21:31102074-31102096 TATTATACATAAGAGGTGGGGGG - Intergenic
1182867422 22:33616204-33616226 CATAATAGTCAAGAAGTGGATGG + Intronic
949256131 3:2048662-2048684 CATTTTACACAAGATTTGGAAGG + Intergenic
951433453 3:22634859-22634881 CACAATAGCCAAGAGGTAGAAGG - Intergenic
956490571 3:69767299-69767321 CTTTAAAGACAAAAGATGGAGGG + Intronic
958626294 3:96628214-96628236 CATAATAGCCCAGAGGAGGAGGG + Intergenic
959149965 3:102596532-102596554 CCTTATAAAAAAGAGGTAGAGGG - Intergenic
959231798 3:103663755-103663777 CATTATTGACAACAGCTGGAAGG + Intergenic
959525368 3:107370896-107370918 CATTAAAGGAAAGAGGTGAATGG + Intergenic
959858929 3:111194639-111194661 AATTACAGAGCAGAGGTGGAAGG + Intronic
964998063 3:162912555-162912577 CATAACAGACAAGAGGTTTAAGG + Intergenic
965842773 3:172926482-172926504 CTTTATGGATAAGAGGTTGAGGG + Intronic
966325072 3:178744888-178744910 AATTATAGAGAAGCAGTGGAAGG + Intronic
967413409 3:189190437-189190459 CATTATTGGCAAGATGTGGGGGG - Intronic
968833589 4:2946737-2946759 CATTATGGACTGGAGGTGGTGGG + Intronic
971116436 4:23651464-23651486 CATTATAGAGCAAAGGTGGAGGG + Intergenic
972332040 4:38073042-38073064 CACAATAGCCAAAAGGTGGAAGG - Intronic
973762199 4:54128074-54128096 CATTATAGACAACAGTTTGGAGG - Intronic
975922923 4:79414410-79414432 CATTACACACAAGAAGTGCAAGG - Intergenic
976644492 4:87373373-87373395 CATCAACAACAAGAGGTGGAGGG - Intronic
976826369 4:89264662-89264684 GATTAGAGATACGAGGTGGAGGG + Intronic
977244533 4:94615450-94615472 AATTATGGATAAGATGTGGATGG + Intronic
977693585 4:99944451-99944473 CATAATAGCCAAGAGGTGAAAGG + Intronic
979844656 4:125491866-125491888 CAGTATGGACTAGTGGTGGAGGG + Exonic
980223460 4:129949315-129949337 CACTATAGGTAAGAGCTGGATGG + Intergenic
980671674 4:136017571-136017593 GATTATACATAAGAGGAGGAAGG + Intergenic
983276460 4:165623185-165623207 CATTATAGTCAATAGTTTGAAGG - Intergenic
984636056 4:182110680-182110702 CAATATGGAAAAGAGGTTGATGG + Intergenic
986079601 5:4376219-4376241 CAGTTTAGAAAAGGGGTGGAAGG + Intergenic
987764166 5:22203664-22203686 CATTATAGGCAAGAGTAGGAAGG - Intronic
988645155 5:33086823-33086845 CTATATAGGAAAGAGGTGGAGGG + Intergenic
988850775 5:35178501-35178523 CATTATAGGGAAGAGATGGTTGG + Intronic
991898897 5:71436748-71436770 CATTATAGGCAAGAGTAGGAAGG - Intergenic
993607670 5:90014193-90014215 CATTAGGGCCAAGAGGGGGAGGG - Intergenic
995371442 5:111423541-111423563 TTTTATAGGCAAGAGGTAGAAGG - Intronic
999857639 5:155612523-155612545 CATTATAGACCAGAGGAGGCTGG + Intergenic
999857913 5:155615146-155615168 CATTATAGACCAGAGGAGGCTGG - Intergenic
1000630916 5:163589839-163589861 CAATAAAGAAAAGAGATGGAGGG - Intergenic
1001636224 5:173212279-173212301 CACAATAGCCAAAAGGTGGAAGG + Intergenic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1004426733 6:15511829-15511851 CATCTTAGAGAAGAGATGGACGG + Intronic
1012982396 6:105844051-105844073 CAAAAGAGAAAAGAGGTGGAAGG + Intergenic
1014135846 6:117888676-117888698 CACAATAGCCAAGGGGTGGAAGG + Intergenic
1016896175 6:149055542-149055564 CATTAGAGACAGGTGGGGGAGGG - Intronic
1018347768 6:162920442-162920464 CATAATAGACCAGAGGAAGAGGG - Intronic
1018623811 6:165758062-165758084 CATTAGTGACAATAAGTGGAAGG + Intronic
1019691976 7:2420443-2420465 CACAATAGCCAAAAGGTGGAAGG - Intronic
1020647635 7:10834260-10834282 CATTATAGATATGTGGTGGGTGG - Intergenic
1021939903 7:25669067-25669089 GGTTAGAGACAAGCGGTGGAAGG - Intergenic
1022644816 7:32220237-32220259 AAGTATACAGAAGAGGTGGAGGG + Intronic
1023229417 7:38009934-38009956 AATTAGAGACAAGAAGAGGAAGG + Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024361782 7:48475996-48476018 CTTTATACAGAATAGGTGGAGGG + Intronic
1024905305 7:54372744-54372766 AATTAAAGGCAAGAGGTGGGAGG + Intergenic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1025934321 7:66022597-66022619 CACCATAGCCAAAAGGTGGAAGG + Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1030554026 7:111000540-111000562 CATTAAAAACAACAGATGGATGG + Intronic
1030804456 7:113898013-113898035 CATTATAGTCAATACTTGGAAGG + Intronic
1032682771 7:134202561-134202583 CACAATAGCCAAAAGGTGGAAGG + Intronic
1032904075 7:136344053-136344075 AATTTTAGACTATAGGTGGAAGG + Intergenic
1034869643 7:154672891-154672913 CAGTATAGACAAGATGGGCATGG + Intronic
1035604348 8:919922-919944 AGTTATAGACATGGGGTGGAAGG - Intergenic
1041337096 8:56798349-56798371 CGTTCTAGGCAAGATGTGGATGG - Intergenic
1043822529 8:84885846-84885868 TATTATATACAAAAGGTAGACGG - Intronic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1047283795 8:123468624-123468646 CACAATAGCCAAGAGGTGGATGG - Intergenic
1048395030 8:134006268-134006290 CATTGTAAAAAGGAGGTGGAGGG + Intergenic
1049527843 8:143137732-143137754 CATAACAGCCAAGAGGTGGAAGG - Intergenic
1050347726 9:4709217-4709239 CATTACAGATGAGAGATGGATGG - Intergenic
1050579256 9:7033654-7033676 CATTACAGAGCAGAGGTGGGGGG - Intronic
1052063863 9:23992699-23992721 CATCAAAGACAAAAGGTAGATGG + Intergenic
1052903425 9:33814905-33814927 CAGTATAGAAAAGGGGAGGAAGG + Intergenic
1058646566 9:107136418-107136440 CAGAATAGACTAAAGGTGGAGGG - Intergenic
1060798101 9:126526342-126526364 CTTTAGAGATAAGAGGTGAATGG + Intergenic
1061098229 9:128472561-128472583 CAGTGTAGAGAAGAGGTAGAAGG + Intronic
1061183309 9:129037478-129037500 CATTGTGGAGAGGAGGTGGAGGG + Intronic
1185871089 X:3665573-3665595 CACTACAGCCAAGAGGTGGAAGG + Intronic
1187664919 X:21596241-21596263 CAATCTATACAAGAGGTGGATGG + Intronic
1190121874 X:47667373-47667395 CATAATAGCCAAGATTTGGAAGG - Intergenic
1192555671 X:72087071-72087093 CATTATTGACAATAGCTGAAAGG + Intergenic
1196362103 X:114874353-114874375 CATTATTGACAACAGTTTGAAGG - Intronic
1196996472 X:121389221-121389243 CATTATAGATAAAAGGAAGAGGG - Intergenic
1199134961 X:144238249-144238271 CATTATACAAAAGGGGAGGAGGG + Intergenic
1199609638 X:149601544-149601566 CATTAGAGACATTATGTGGATGG - Intronic
1199629478 X:149767808-149767830 CATTAGAGACATTATGTGGATGG + Intergenic
1200792966 Y:7315709-7315731 CACTACAGCCAAGAGGTGGAAGG - Intergenic
1201947626 Y:19528851-19528873 CATTAAAGGCAAGAGGAGAATGG + Intergenic