ID: 918886885

View in Genome Browser
Species Human (GRCh38)
Location 1:190205282-190205304
Sequence GAACCATATCAACCGCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918886885_918886886 0 Left 918886885 1:190205282-190205304 CCAGTAAGCGGTTGATATGGTTC 0: 1
1: 0
2: 1
3: 3
4: 42
Right 918886886 1:190205305-190205327 TCTTTTCTACCCGCCACACATGG 0: 1
1: 0
2: 1
3: 15
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918886885 Original CRISPR GAACCATATCAACCGCTTAC TGG (reversed) Intronic
901693556 1:10990190-10990212 AAACCATATCAGTCCCTTACTGG + Intergenic
906162430 1:43660258-43660280 GAAACATGTAAACCACTTACAGG - Intronic
906676733 1:47698574-47698596 GAACCATATGAACCACTTAATGG + Intergenic
907392421 1:54166950-54166972 AAACCATATCATCCCCTTAGAGG + Intronic
918886865 1:190205051-190205073 GAACCATATCAACTGCATACTGG - Intronic
918886885 1:190205282-190205304 GAACCATATCAACCGCTTACTGG - Intronic
924467179 1:244309198-244309220 AAACCATATCATCTGCTTATTGG - Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1066356659 10:34691156-34691178 GAACCATATCATCTGCAAACAGG - Intronic
1096165575 12:49420657-49420679 GAACCATTTTAACTTCTTACTGG - Intronic
1099611270 12:84874386-84874408 AAACCATATAAAATGCTTACCGG - Intronic
1107105887 13:36642098-36642120 AATCCATTTCAACCACTTACTGG - Intergenic
1111881464 13:93962283-93962305 GAACCTTATCAAATGCTTAAGGG - Intronic
1115391979 14:32864244-32864266 GAACCATATCAACTGCAAACAGG + Intergenic
1118801348 14:69192217-69192239 GAATCATATCAAAAGCTTATCGG - Intronic
1140436002 16:74947526-74947548 GAAATATATCAACCACTTACAGG + Intronic
1141206223 16:81935029-81935051 AAACCATATCACCCACTTAGTGG + Intronic
1147518338 17:41143256-41143278 TAACCATATCAACAGGTTATGGG + Intergenic
1149243254 17:54675705-54675727 AAACCATATCATCCCCTTAATGG + Intergenic
1149853064 17:60052998-60053020 AAACCATATCAGCCACTTAATGG - Intronic
1149863152 17:60135479-60135501 GAACGATTTCAACTGCGTACTGG + Intergenic
1150533412 17:66010387-66010409 GAATCATATCATCCGCAAACAGG + Intronic
1150658815 17:67058166-67058188 CCCCCATATCAACCTCTTACTGG + Intergenic
1151640519 17:75389137-75389159 GGACCAGATCAAACTCTTACTGG + Intronic
933619071 2:84516185-84516207 CACCCATCTCAACCTCTTACAGG - Intergenic
934184830 2:89662477-89662499 TAACAATATAAACAGCTTACTGG - Intergenic
939373794 2:141337688-141337710 AAACCATATTAACAACTTACTGG - Intronic
1173456529 20:43206825-43206847 AAACCATATCAATCACCTACTGG + Intergenic
955580792 3:60419127-60419149 AAATCATATCTACCACTTACTGG + Intronic
957805124 3:85137775-85137797 AAGCCATATCAAATGCTTACAGG - Intronic
959734234 3:109639384-109639406 GAACCATGTCATCCGCAAACAGG + Intergenic
968003803 3:195225645-195225667 AAACCATATCAACCAGTTTCTGG - Intronic
969649225 4:8453892-8453914 CAACCATTTCAAGCTCTTACAGG - Intronic
972174216 4:36383446-36383468 GAACCACATCAATTGATTACAGG - Intergenic
973836676 4:54817062-54817084 GAATCATATCCACCATTTACTGG - Intergenic
991365629 5:65865103-65865125 AAACAATATAAACAGCTTACAGG - Intronic
1009581124 6:65535236-65535258 AAACCATATCAAGCTCTTTCTGG - Intronic
1015161655 6:130159049-130159071 AAACCATATCAACCTCTGATTGG - Intronic
1027624585 7:80530845-80530867 AAACCATATCAACCTCATAAAGG - Intronic
1034762894 7:153690109-153690131 GAGCCAGATGAACCTCTTACAGG + Intergenic
1038073086 8:24039460-24039482 AAACCATGACAGCCGCTTACAGG - Intergenic
1042167980 8:65964947-65964969 TAAACACATCAAACGCTTACTGG + Intergenic
1045194059 8:99912090-99912112 AAACCATATCACCCCCTTTCTGG - Intergenic
1051371019 9:16359113-16359135 AAACCATATCAAGCTCTTAGAGG - Intergenic
1052484379 9:29077783-29077805 GAAACATATCAACCAATCACAGG + Intergenic
1186413194 X:9361560-9361582 AAACCATATCAAACACTTATTGG - Intergenic
1194512521 X:94813614-94813636 GAACCATATCATCTGCAAACAGG + Intergenic