ID: 918888689

View in Genome Browser
Species Human (GRCh38)
Location 1:190234434-190234456
Sequence TCATAGTTACTGCAGCCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918888687_918888689 6 Left 918888687 1:190234405-190234427 CCAGAACAGAACTGACAGAATCT 0: 1
1: 0
2: 2
3: 5
4: 160
Right 918888689 1:190234434-190234456 TCATAGTTACTGCAGCCAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918888689 Original CRISPR TCATAGTTACTGCAGCCAAG AGG Exonic
900846523 1:5107332-5107354 TCGTAGATATTGCAGCCCAGTGG + Intergenic
901177052 1:7311725-7311747 TCATAGGTAATCCAGCCAGGTGG + Intronic
903194777 1:21677331-21677353 TGAAAGTAACTGCAGCCCAGCGG - Intergenic
905915031 1:41678691-41678713 TCACAGTCACTGTAACCAAGAGG - Intronic
908008674 1:59753254-59753276 TCAGATTTCCTGCAGCCAAGTGG + Intronic
910292446 1:85612672-85612694 TTATACCCACTGCAGCCAAGAGG + Intergenic
911695063 1:100881633-100881655 TTATATTTACTGCAGTCATGGGG - Intronic
912961516 1:114199994-114200016 GCATAGTTACAATAGCCAAGAGG + Intergenic
916854044 1:168731596-168731618 TCATGGTTACTGAAGCGAGGGGG + Intergenic
917671010 1:177273509-177273531 TCATAGTTGCTGCAGCCCAGAGG - Exonic
918888689 1:190234434-190234456 TCATAGTTACTGCAGCCAAGAGG + Exonic
920294014 1:204944848-204944870 TCCTGATTACTCCAGCCAAGAGG - Intronic
920430487 1:205915462-205915484 TCACAGTGGCTGCAACCAAGAGG + Intronic
920724562 1:208421908-208421930 TCATCGTCATTTCAGCCAAGGGG - Intergenic
922190890 1:223317392-223317414 CCATAGACACAGCAGCCAAGAGG - Intronic
923801851 1:237217913-237217935 TAATAGTTAATGGAGACAAGGGG + Intronic
1064192945 10:13223326-13223348 CAACAGTTACAGCAGCCAAGAGG + Intronic
1065237239 10:23665783-23665805 TCATAGTGTCTGCTGCCCAGAGG - Intergenic
1065320551 10:24505118-24505140 TCATATTACCTGTAGCCAAGAGG - Intronic
1068624635 10:59228851-59228873 TCTTAGTTACAGTAGCTAAGAGG - Intronic
1069088568 10:64171525-64171547 TCTTGGTTACTGGAACCAAGGGG + Intergenic
1076336915 10:129712998-129713020 ACAGAGACACTGCAGCCAAGAGG + Intronic
1079733852 11:23970882-23970904 TCATAGTAATTCCAGCCAAAGGG + Intergenic
1080231742 11:30023954-30023976 CCAGAGGTTCTGCAGCCAAGAGG - Intergenic
1083322429 11:61855824-61855846 TCATACTTATTGCAGTCAGGAGG - Intronic
1083584006 11:63843367-63843389 TCATAGTTTCTGAGGCCCAGAGG - Intronic
1087062903 11:93999598-93999620 ACATAGCTACTGGAGCCAGGTGG + Intergenic
1088382447 11:109209588-109209610 TCATAATGACAGCAACCAAGAGG - Intergenic
1092930778 12:13313605-13313627 TCAAAGTATCTGCAGACAAGAGG - Intergenic
1093066122 12:14660042-14660064 ACACAGTTACAGGAGCCAAGCGG + Intronic
1098681573 12:73362446-73362468 ACAGGGTTAGTGCAGCCAAGGGG + Intergenic
1102770829 12:115474485-115474507 TTATAGTTCATGCAGTCAAGAGG + Intergenic
1102903804 12:116659451-116659473 TCAGAGTTTCTGCAACCCAGAGG + Intergenic
1110917934 13:81046739-81046761 TCATAGGAACTGCACCAAAGGGG + Intergenic
1114257640 14:21016953-21016975 CCAAAGTTAGTGCAGCCAAACGG + Exonic
1114379767 14:22190194-22190216 CCATAGGTACTGAAGCCAAAGGG - Intergenic
1121495358 14:94388380-94388402 TCATAATAACAGCAGCCATGAGG - Intronic
1121970098 14:98348081-98348103 TCATAATTACTGAAACCAAATGG - Intergenic
1127082851 15:55397544-55397566 TCAAAGGTACAGCAGCCAACAGG + Intronic
1132151237 15:99461020-99461042 TCACAGGAACTGCAGCAAAGTGG - Intergenic
1133214943 16:4286376-4286398 TCATAAGAACTGCAGCCAGGAGG + Intergenic
1133697534 16:8279155-8279177 TCTAAGTTACTGCAGCGGAGAGG - Intergenic
1134223945 16:12377124-12377146 ACATAGTTACTGCAGCAGAAAGG - Intronic
1135763413 16:25155988-25156010 TCATAGTTACTGTGGTCAAAGGG - Intronic
1139321015 16:66114068-66114090 GCAGATTTACTGCACCCAAGTGG - Intergenic
1152599598 17:81255364-81255386 TTAGTTTTACTGCAGCCAAGAGG - Intronic
1158133300 18:54177365-54177387 TCAAAGTTCCTGCAGTCGAGTGG - Intronic
1158596680 18:58822791-58822813 TCATAGATACCGCATACAAGTGG - Intergenic
1159726496 18:71966996-71967018 TCAAAGTTAATGCACTCAAGTGG - Intergenic
1164649172 19:29879680-29879702 TCACAGTTACTGTAGCCCAGGGG + Intergenic
1164920183 19:32083458-32083480 TCCTGATTACTGGAGCCAAGGGG - Intergenic
926712197 2:15890608-15890630 TCAAACTTCTTGCAGCCAAGAGG - Intergenic
929229350 2:39543272-39543294 TCATGATTACTGTAGCAAAGTGG - Intergenic
930015032 2:46964327-46964349 TCATACTTCTTGGAGCCAAGAGG + Intronic
930645379 2:53900786-53900808 CCATAGTCACGCCAGCCAAGAGG + Intronic
932537126 2:72610725-72610747 ACATAGATACCACAGCCAAGAGG + Intronic
932653967 2:73591727-73591749 TTATAGTTATTAAAGCCAAGAGG + Intronic
942652389 2:178182282-178182304 CCTTAATTACTGCAGCCAGGGGG - Intergenic
945113807 2:206390945-206390967 TCATAGTTTCTTCAGCCTAGTGG + Intergenic
945964879 2:216175960-216175982 TCATTGCCACTGCCGCCAAGAGG - Intronic
1169529202 20:6465956-6465978 TCAGAGTTACTCTACCCAAGGGG - Intergenic
1171095713 20:22330851-22330873 GCAGAATTACTGCAGGCAAGGGG - Intergenic
1172447038 20:34998676-34998698 TCAGCGTTAGTGCAGCCCAGTGG - Intronic
1173669117 20:44785550-44785572 TCTTAGTTCCTGCAGAAAAGAGG + Intronic
949604944 3:5642532-5642554 TCAAAGTTACTGCAGTAAGGAGG + Intergenic
952127989 3:30324531-30324553 TCATAGTTACTGGAAACAATGGG + Intergenic
953878286 3:46678778-46678800 TCATAATGACTGGAGCAAAGGGG - Intronic
953977840 3:47395734-47395756 TGATAGCAACTGCAGGCAAGAGG - Intronic
955559200 3:60170399-60170421 TCAAAGTAACTTCAGCCAACAGG - Intronic
958549725 3:95596044-95596066 TCATAGTCACTACTACCAAGTGG - Intergenic
969917270 4:10502867-10502889 TCAGAGTGACAGAAGCCAAGAGG + Intronic
976415246 4:84765931-84765953 CCACAGTTACAGCAGCCATGAGG - Exonic
976499822 4:85774744-85774766 TCCTAGCTGCTGGAGCCAAGGGG + Intronic
977659726 4:99569296-99569318 TCAGAGCTATTACAGCCAAGAGG + Intronic
977716282 4:100187514-100187536 TCATAGCAACTGCAGCTAACAGG - Exonic
978502029 4:109419896-109419918 TCATCTTTACTGCAGCCCAGTGG - Intergenic
982699184 4:158640066-158640088 TTTTTGTTACAGCAGCCAAGTGG + Intronic
984273363 4:177575475-177575497 TCATGAATACTGCAGTCAAGGGG - Intergenic
987676440 5:21079162-21079184 TCCTACTGACTGCAGGCAAGTGG + Intergenic
988808041 5:34758903-34758925 TCAGAGTTATTCCACCCAAGGGG + Intronic
989358802 5:40575579-40575601 TAACAGTTACAGCAGCCAAAGGG - Intergenic
998901383 5:146858850-146858872 TCATTGTTACTCTTGCCAAGTGG - Intronic
1003829040 6:9985865-9985887 TCAAACTTTCTGCAGACAAGAGG + Intronic
1013826910 6:114223550-114223572 CCAGAGTTTCTGCAGTCAAGAGG - Intronic
1014365429 6:120534934-120534956 TCACCCTTACTGCATCCAAGGGG + Intergenic
1015276038 6:131384173-131384195 TCACAGTAACTGCAGCCAGATGG + Intergenic
1019885415 7:3900114-3900136 TCATGGTTTCTTCAGCAAAGAGG - Intronic
1026472690 7:70707718-70707740 CCATAGTTACTGCAGCGCAGTGG + Intronic
1026625486 7:71988320-71988342 TCATAGATGCTGGAGCCAACTGG - Intronic
1033073481 7:138226193-138226215 TGTTGGTTACTGCAGGCAAGGGG - Intergenic
1039699629 8:39948740-39948762 TCAGAGTTACTCCAGCCAAATGG - Intronic
1039830761 8:41212038-41212060 TCATAGATTCTTCAGCCAAGAGG - Intergenic
1042802236 8:72732069-72732091 TGGAAGTCACTGCAGCCAAGTGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1046339549 8:112835314-112835336 TCATATTTTCTGAAGCCATGCGG + Intronic
1046850570 8:118967920-118967942 TGTTAGTTCCTGCAGCCTAGGGG + Intergenic
1047291502 8:123534798-123534820 TCATAGTTACTGCAACAAGGAGG - Exonic
1048827241 8:138440118-138440140 TTATAGTTCCTGCAGCCCAGTGG - Intronic
1049494412 8:142923009-142923031 ACATGGTGACTGCAGCCAGGCGG - Intergenic
1050102374 9:2132308-2132330 TCATACTTAATGCAGCCCAGAGG - Intronic
1050804612 9:9657935-9657957 ACATATTTAATTCAGCCAAGTGG + Intronic
1052159142 9:25233842-25233864 TCATAGTTACAGCAGCAATAGGG - Intergenic
1052634396 9:31082700-31082722 TCATAATTTCTGGAGCAAAGAGG - Intergenic
1053458498 9:38250369-38250391 TCACAGTGACCCCAGCCAAGGGG - Intergenic
1054743405 9:68830751-68830773 TCAGTGTTACTGCAGCCAGTGGG + Intronic
1055212658 9:73815985-73816007 ACATAGTTACTGTAACCAAGAGG - Intergenic
1057886931 9:98836895-98836917 CCATAGTATCTGCAGCAAAGAGG - Intronic
1185666290 X:1767923-1767945 CCAGAGTGACTGCAGCCCAGAGG + Intergenic
1188304909 X:28550181-28550203 GGATAGTTAATGCATCCAAGGGG - Intergenic
1188779674 X:34266047-34266069 TCATGCTTGCTGCAGCCAATTGG - Intergenic
1190031421 X:46976939-46976961 TCAAAGTCACAGCAGCCCAGGGG - Intronic
1196972656 X:121126345-121126367 TCATATTGGCTGCAGCAAAGGGG - Intergenic
1199109614 X:143915099-143915121 TCACAGTTAATGAAGCAAAGTGG - Intergenic
1202147728 Y:21817449-21817471 CCATAGGGACTGGAGCCAAGAGG - Intergenic