ID: 918899785

View in Genome Browser
Species Human (GRCh38)
Location 1:190399841-190399863
Sequence CATCTAAATTTAGCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918899782_918899785 24 Left 918899782 1:190399794-190399816 CCATAATTAGGATCATTCACTTT 0: 1
1: 0
2: 1
3: 19
4: 187
Right 918899785 1:190399841-190399863 CATCTAAATTTAGCTACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918899785 Original CRISPR CATCTAAATTTAGCTACTCC TGG Intronic
901262009 1:7878856-7878878 TATCTAAGTATAGCTACTCCTGG - Intergenic
901960822 1:12825298-12825320 CATCTAAATCCAGGTACTCAAGG + Exonic
901967418 1:12879900-12879922 CATCTAAATCCAGGTACTCAAGG + Exonic
901975216 1:12939031-12939053 CATCTAAATCCAGGTACTCAAGG + Exonic
901986203 1:13077174-13077196 CATCTAAATCCAGGTACTCAAGG - Exonic
901995609 1:13149593-13149615 CATCTAAATCCAGGTACTCAAGG + Intergenic
902009959 1:13262733-13262755 CATCTAAATCCAGGTACTCAAGG - Exonic
902017755 1:13321886-13321908 CATCTAAATCCAGGTACTCAAGG - Exonic
904871561 1:33622297-33622319 CATTTAAGTTTGGCTCCTCCAGG + Intronic
906898379 1:49805587-49805609 CATTTAATTTCAGCTACTCAAGG - Intronic
908067802 1:60426393-60426415 CAACCAAATATAGCTACTCTGGG + Intergenic
908491742 1:64651238-64651260 CATAAAAATTTAGGAACTCCTGG + Intronic
914941486 1:152027021-152027043 CATCCTAATTTTGCTAGTCCTGG + Intergenic
917087504 1:171318701-171318723 CAACTAAATTTAGCTATTACCGG - Intronic
918899785 1:190399841-190399863 CATCTAAATTTAGCTACTCCTGG + Intronic
920709148 1:208278456-208278478 CATGTAAGTTTGGCTACCCCAGG - Intergenic
923108225 1:230870314-230870336 CATATATCTTTATCTACTCCTGG + Intergenic
1064096155 10:12426013-12426035 CAGCTAAAGTTAGCTAATGCTGG - Intronic
1064557016 10:16557520-16557542 GATATAAAAATAGCTACTCCTGG + Intergenic
1066748875 10:38632315-38632337 CATCTAGGATTAGCTCCTCCAGG - Intergenic
1071214706 10:83387269-83387291 AATATAAATATAGCTGCTCCTGG + Intergenic
1072605105 10:96974866-96974888 CATCTAAATTTAGGTGCTATTGG + Intronic
1073170479 10:101503486-101503508 CATCTAAACTAAGCTTTTCCTGG + Intronic
1074445356 10:113517242-113517264 AATCTGAGTTTAGCCACTCCAGG + Intergenic
1075042105 10:119116337-119116359 TATCTAAATATAGCTACCTCTGG + Intronic
1077811375 11:5641284-5641306 CATCCAAATTTTACTACTCTGGG - Intronic
1081295974 11:41389841-41389863 CATCTGAATTGTGCTAATCCTGG + Intronic
1081905509 11:46667063-46667085 CCTCTGTCTTTAGCTACTCCTGG - Intronic
1083547410 11:63559178-63559200 CCTGTAATTCTAGCTACTCCGGG + Intronic
1090515452 11:127421321-127421343 GATATAATTATAGCTACTCCTGG + Intergenic
1099403940 12:82236642-82236664 GATATAAATATAGCTACTCCTGG + Intronic
1099776835 12:87144131-87144153 TCTGTAAATTTAGCTATTCCAGG - Intergenic
1101103180 12:101415044-101415066 CATCATAATTTAGTTATTCCAGG - Intergenic
1106896791 13:34311879-34311901 CATTTAAATTTTGATATTCCTGG + Intergenic
1106910395 13:34457082-34457104 CCTATAAATTTGACTACTCCAGG - Intergenic
1107563833 13:41582113-41582135 CAACTGAATTCAGCTATTCCCGG - Intronic
1108726926 13:53193024-53193046 CTTCTAAACTCAGCAACTCCAGG + Intergenic
1111126627 13:83918004-83918026 CATCTAAGAATAGCTTCTCCAGG + Intergenic
1115490583 14:33953970-33953992 AAACTAAATTTACCCACTCCTGG - Intronic
1115639622 14:35325536-35325558 TATTAAAAGTTAGCTACTCCAGG + Intergenic
1124868525 15:33517672-33517694 CATCTTAATTTTTCTACCCCAGG + Intronic
1126999931 15:54490940-54490962 CAGCTAAATTCATCTCCTCCAGG + Intronic
1127196684 15:56593598-56593620 GATATAAGTATAGCTACTCCTGG - Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1134860642 16:17557326-17557348 CATGTAATCTCAGCTACTCCGGG - Intergenic
1137414095 16:48256637-48256659 CGTCTCAATTTAGCAACTGCAGG - Exonic
1138325879 16:56167107-56167129 CAACTGAATTCAGCAACTCCAGG + Intergenic
1139059038 16:63226069-63226091 CATCTAAAAGAAGCAACTCCTGG + Intergenic
1139869206 16:70090793-70090815 AGTCTAAAATTAGCTACTCATGG - Intergenic
1140160239 16:72482927-72482949 CATGAAAATTTAACTACTTCAGG + Intergenic
1143988382 17:10935270-10935292 CATATTATTTTACCTACTCCAGG + Intergenic
1148380501 17:47193389-47193411 CCTGTAAATTCAGCTACTCAGGG - Intergenic
1150910552 17:69382801-69382823 CCTCTAAATTCAGCCAGTCCTGG - Intergenic
1153174961 18:2360996-2361018 CATCAAAAATTATATACTCCAGG + Intergenic
1155241816 18:23871263-23871285 CTTCTAAATGTAAATACTCCAGG + Intronic
1156028905 18:32690001-32690023 TATCCACATTTAGCTACTCAGGG + Intronic
1156790956 18:40974110-40974132 GATATAAGTATAGCTACTCCTGG + Intergenic
1158318007 18:56233574-56233596 CATGGAAATTTAACTTCTCCTGG - Intergenic
1158868289 18:61659203-61659225 CATCTAAATTTAAGAACTCCAGG + Intergenic
1159329632 18:66974488-66974510 CATTTAACTTAAGATACTCCAGG + Intergenic
1161124154 19:2546545-2546567 CTTCTAAATATAGCTGCCCCGGG - Intronic
1164242642 19:23403484-23403506 CCTGTAATTTCAGCTACTCCGGG - Intergenic
1165637303 19:37352198-37352220 GATATTAATATAGCTACTCCAGG + Intronic
1168547218 19:57263436-57263458 CACTTAAAATTAGCTAGTCCTGG - Intergenic
926776122 2:16424941-16424963 CATCCAAATTTAGGTAATACAGG - Intergenic
926944575 2:18172847-18172869 CCTCTACATTTAGCTTCTCTGGG - Intronic
928299828 2:30115302-30115324 AATATAAATTTAGCTGCTCGAGG + Intergenic
928495383 2:31826283-31826305 GATATAAATATAGCTACTCCTGG + Intergenic
931050135 2:58404102-58404124 CATCTAACATTAGATGCTCCAGG - Intergenic
931551883 2:63455511-63455533 GATATAAATGTAACTACTCCTGG - Intronic
933263961 2:80161137-80161159 CCTGTAATTCTAGCTACTCCAGG - Intronic
933847441 2:86337348-86337370 CTGCTAAATTTAGCTGCGCCGGG + Intronic
937668052 2:124509274-124509296 CATCTGAATTTAGTTATTCTAGG + Intronic
940985756 2:160050503-160050525 CATGTAAATAAAGCTACACCTGG - Intronic
942986601 2:182150766-182150788 CCTCTAAATTTAGCTAATCTAGG + Intronic
947689822 2:232124754-232124776 TATCCAAATTTAGATACACCAGG + Intronic
948036881 2:234864876-234864898 CATTTATATTGAGTTACTCCTGG + Intergenic
1169511218 20:6266371-6266393 CATCTAAAATTAACTACCACAGG + Intergenic
1174588997 20:51630327-51630349 TGCCTAAATTTTGCTACTCCAGG + Intronic
1178276694 21:31245276-31245298 CTTCTGAATGTACCTACTCCTGG + Intronic
1181349089 22:22242698-22242720 CATCTAACTCTAGATGCTCCAGG + Intergenic
1182570114 22:31230720-31230742 CCGCTAAATTTAGTGACTCCAGG + Intronic
1185326242 22:50227173-50227195 CATCTAAAGTTAGTTGCCCCAGG - Intronic
949931997 3:9086105-9086127 CATCTGAATTTAGCTTCTAGGGG - Intronic
951357113 3:21681045-21681067 CATTTACATTTAGCTAGTCTGGG + Intronic
953127162 3:40102387-40102409 CATCAGGATTTAGCTTCTCCAGG + Intronic
955590277 3:60527490-60527512 CAGATGAATTTAGCTCCTCCTGG + Intronic
955841995 3:63122534-63122556 CTTCTATATTTAGCTGCTTCTGG + Intergenic
957066772 3:75529456-75529478 GATGTAAGTTTAGCTACTCCTGG - Intergenic
960140816 3:114150455-114150477 CATATAATTTTAGTTACTTCAGG + Intronic
961286371 3:125808598-125808620 GATGTAAGTTTAGCTACTCCTGG + Intergenic
961940055 3:130627646-130627668 CATGTAATCTTAGCCACTCCAGG + Intronic
962156433 3:132953423-132953445 GATCTAAATGTAGCTTCTTCTGG + Intergenic
965032046 3:163383511-163383533 TATTTAAATTTATCTAGTCCTGG - Intergenic
972042150 4:34616176-34616198 CCACTAAATTTAGCTACTTGAGG + Intergenic
973255564 4:48108774-48108796 CATCTGAATTAAACTACTCTGGG - Intronic
973989015 4:56385143-56385165 CATCTGAGTTTAGCTCCTACTGG - Intronic
977636080 4:99300047-99300069 ATTCTAAATTTAGCTTATCCAGG + Intergenic
982634526 4:157876830-157876852 GATATCAATATAGCTACTCCAGG + Intergenic
983128666 4:163986813-163986835 CATCTCAATTTATCTAATTCAGG + Intronic
983426147 4:167585890-167585912 CATACATATATAGCTACTCCAGG + Intergenic
984541683 4:181046197-181046219 CTTATAAATTTAGCTAATCTAGG + Intergenic
984716564 4:182930988-182931010 GATCTCAATTTAGCTATTACAGG + Intergenic
986735159 5:10662810-10662832 CAGCTAAATTTAGCTCCCCTTGG + Intergenic
988436636 5:31182828-31182850 CATTTAAATTTAGATATTTCTGG - Intergenic
993849344 5:92986609-92986631 GAGATAAATATAGCTACTCCAGG - Intergenic
994531158 5:100973418-100973440 GATATAAGTATAGCTACTCCTGG - Intergenic
995540614 5:113182740-113182762 CTTCTATATTTATCTACTTCCGG + Intronic
1004782749 6:18929949-18929971 CATCTTAATCGAGCTAATCCAGG - Intergenic
1007080648 6:39100709-39100731 CATCTAAACTTTGCCAGTCCTGG - Intergenic
1008159802 6:48063166-48063188 AATCTACTTTTAGCTAATCCTGG + Intronic
1010060972 6:71622412-71622434 CATTTAAAGTTTTCTACTCCTGG + Intergenic
1010519234 6:76811935-76811957 CATTTAAATGTAGCTGATCCAGG + Intergenic
1012740566 6:103011627-103011649 CATCTAAAGATAGCTAGTACAGG + Intergenic
1017669119 6:156753098-156753120 CAAATAAATTTTGCTACTTCGGG + Intergenic
1021942511 7:25692306-25692328 CATCTGAATTTAACAACTCTGGG - Intergenic
1023377717 7:39575213-39575235 CATCTAAAATAAGTTACTTCTGG + Intronic
1024966388 7:55025734-55025756 CATCGAAATTGAGCCACACCAGG + Intronic
1028700108 7:93767671-93767693 CATCTAAATATGGGTACACCAGG + Intronic
1029208489 7:98884829-98884851 CATGTAAATTTCCCTTCTCCTGG + Intronic
1030885509 7:114931690-114931712 CCTCTAAATTTTCCTGCTCCAGG - Intronic
1036252906 8:7178159-7178181 GATGTAAGTTTAGCTACTCCTGG - Intergenic
1036364591 8:8109303-8109325 GATGTAAGTTTAGCTACTCCTGG + Intergenic
1037254079 8:16932084-16932106 GATATAAATCTAGCCACTCCAGG + Intergenic
1042435569 8:68760760-68760782 CTTCTTAGTTTTGCTACTCCAGG - Intronic
1052501313 9:29294578-29294600 GATATAAATATAGCTACTCCTGG - Intergenic
1053615758 9:39764315-39764337 GATATAAATATAGATACTCCTGG - Intergenic
1053898693 9:42770964-42770986 GATATAAATATAGATACTCCTGG + Intergenic
1054237762 9:62578075-62578097 GATATAAATATAGATACTCCTGG + Intergenic
1054551893 9:66612583-66612605 GATATAAATATAGATACTCCTGG + Intergenic
1056494801 9:87145695-87145717 CATCTAGATTTTGCTTCCCCAGG - Intergenic
1058476562 9:105340319-105340341 TATATAAATTTGACTACTCCAGG - Intronic
1059697280 9:116741240-116741262 CATTTAAATTGAGGTATTCCAGG + Intronic
1060834133 9:126742198-126742220 CATCATAATTTAGCTACCCAAGG + Intergenic
1062003398 9:134227923-134227945 CTTCAAAATTTTGCCACTCCAGG + Intergenic
1187643828 X:21324439-21324461 CATATTAATGTAGCCACTCCAGG + Intergenic
1193929474 X:87534161-87534183 CTAGTAAATGTAGCTACTCCTGG + Intronic
1196485382 X:116200960-116200982 GATCTAAGTGTGGCTACTCCTGG + Intergenic
1199104001 X:143840284-143840306 AATCTAAATATTGCTATTCCTGG - Intergenic
1201548841 Y:15197542-15197564 CATCTCAGTTTATCTACTTCTGG - Intergenic
1201773519 Y:17641272-17641294 CCTGTAAATTCAGCTACTCGGGG + Intergenic
1201785628 Y:17774860-17774882 CCTATAATTTTAGCTACTCAGGG + Intergenic
1201815925 Y:18131128-18131150 CCTATAATTTTAGCTACTCAGGG - Intergenic
1201828036 Y:18264714-18264736 CCTGTAAATTCAGCTACTCGGGG - Intergenic