ID: 918902291

View in Genome Browser
Species Human (GRCh38)
Location 1:190438791-190438813
Sequence CACTATTATGGCATCTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918902291_918902295 23 Left 918902291 1:190438791-190438813 CCTCTCAAGATGCCATAATAGTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 918902295 1:190438837-190438859 GATTGTGACAGGAAGAGTAAAGG 0: 1
1: 0
2: 1
3: 18
4: 323
918902291_918902294 12 Left 918902291 1:190438791-190438813 CCTCTCAAGATGCCATAATAGTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 918902294 1:190438826-190438848 TTATCAATGTAGATTGTGACAGG 0: 1
1: 0
2: 1
3: 10
4: 135
918902291_918902296 28 Left 918902291 1:190438791-190438813 CCTCTCAAGATGCCATAATAGTG 0: 1
1: 0
2: 0
3: 4
4: 100
Right 918902296 1:190438842-190438864 TGACAGGAAGAGTAAAGGATAGG 0: 1
1: 1
2: 1
3: 21
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918902291 Original CRISPR CACTATTATGGCATCTTGAG AGG (reversed) Intronic
909623324 1:77688928-77688950 CACTATCATGGCATTATGATTGG + Intergenic
918217978 1:182409722-182409744 CACTTTTATGCCATCTTTAAAGG + Intergenic
918902291 1:190438791-190438813 CACTATTATGGCATCTTGAGAGG - Intronic
921986283 1:221316432-221316454 GACTACTATAGAATCTTGAGAGG - Intergenic
923185267 1:231566701-231566723 TACTATGATGGCATCATGTGTGG + Intronic
1063924053 10:10960038-10960060 CAGTGTAATGCCATCTTGAGTGG - Intergenic
1066211333 10:33241780-33241802 AACTATAATGGCAACGTGAGAGG - Intronic
1067107820 10:43377347-43377369 CACTATCAGGGAATCTTGGGTGG + Intergenic
1067693548 10:48519738-48519760 CCATTTGATGGCATCTTGAGAGG + Intronic
1068530553 10:58181043-58181065 CACTATTGGAGGATCTTGAGTGG + Intergenic
1069500412 10:68948027-68948049 TACTCCTATGGCATCTTAAGAGG - Intergenic
1075503950 10:123005626-123005648 CAATTTGATGGCATCTGGAGTGG + Intronic
1077843460 11:5999862-5999884 CATTATTCTTGCATCTTGTGTGG - Intergenic
1079502969 11:21123002-21123024 CACCATTTTGAGATCTTGAGGGG - Intronic
1084158815 11:67332983-67333005 AACAATGATGGCATCTTCAGTGG - Intronic
1085871925 11:80360408-80360430 AACAATGATGGCATCTTGAATGG + Intergenic
1086093189 11:83024338-83024360 CACTATTTTGGCATGTAGATGGG - Intronic
1087934556 11:104017273-104017295 TTTTATTATGGCAGCTTGAGCGG + Intronic
1088528029 11:110777713-110777735 CATTTTTATGGAAACTTGAGGGG + Intergenic
1088867375 11:113861482-113861504 CACTATTATATCATGTAGAGGGG + Intronic
1094734214 12:33215507-33215529 TACTATTAAGGCATCTGGAAAGG + Intergenic
1096940390 12:55338217-55338239 AACAATGATGGCATCTTAAGTGG + Intergenic
1098510586 12:71309241-71309263 CACTATTATGGCTATTTGTGTGG - Intronic
1106136802 13:26979653-26979675 CACAATTATGGGATCCTGAAAGG - Intergenic
1111920630 13:94407208-94407230 CACTATTATGCCATTGTTAGGGG - Exonic
1114308470 14:21444537-21444559 CACTAGTATCCCATTTTGAGTGG + Intronic
1117197091 14:53351304-53351326 CACTATTATTGAATGTTGAATGG + Intergenic
1117972291 14:61264065-61264087 GGCTATAATGGCATCCTGAGAGG - Intronic
1124526780 15:30461504-30461526 TTCTGTTATGGCAGCTTGAGCGG + Intergenic
1127962804 15:63902309-63902331 GACTGTTATGGAATCTTCAGAGG + Intergenic
1130840038 15:87690021-87690043 CACTATTCTGGCATCCAGTGAGG + Intergenic
1135619442 16:23942929-23942951 CACGATTATTGTCTCTTGAGGGG + Intronic
1149853913 17:60061967-60061989 CACAATTTTGGCATCTTAAGGGG + Intronic
1150466012 17:65393199-65393221 CCATATTTTGGCATCTTGATTGG - Intergenic
1153058137 18:968146-968168 CACAATCATGGCATCTTGGTAGG + Intergenic
1155785093 18:29886514-29886536 CACCAGTATGGAATCATGAGAGG - Intergenic
1156519641 18:37711340-37711362 CACTTTCATGGGATCTTAAGAGG + Intergenic
1159066990 18:63581089-63581111 AACAATGATGGCATCTTCAGTGG - Intergenic
926442533 2:12905160-12905182 CATTATTCTAACATCTTGAGTGG + Intergenic
930717830 2:54609478-54609500 AACAATGATGGCATCTTCAGTGG + Intronic
930946497 2:57083325-57083347 CACTATTATGGGATTTTTGGGGG + Intergenic
931792318 2:65675154-65675176 CAATATAATGGCATTTTCAGAGG - Intergenic
932473745 2:71985672-71985694 CAATATTTTAGCATTTTGAGTGG + Intergenic
946910396 2:224455019-224455041 CACTTTCATGGCTTCTTGATAGG + Intergenic
947415584 2:229891952-229891974 CAATACTATGGCATATTTAGAGG + Intronic
947716794 2:232344295-232344317 AAATATTATGGCAGCCTGAGGGG + Intronic
1169586468 20:7091354-7091376 AACTAATATGTCATCTTTAGGGG - Intergenic
1170942571 20:20861012-20861034 AACTATTAAGGCATCTTCATTGG + Intergenic
1177300306 21:19235591-19235613 CATTATTATGTAATCTTTAGTGG - Intergenic
1184944043 22:47788376-47788398 CATTTTTATGGCATTTTTAGGGG - Intergenic
957263662 3:77932241-77932263 CACTAGTTAAGCATCTTGAGAGG - Intergenic
958167068 3:89889712-89889734 CAGTATTCTGGCATCTTGGATGG + Intergenic
962473926 3:135739507-135739529 CACTATGCTGGGATCTTGATAGG - Intergenic
966026446 3:175288773-175288795 CATTATTGTGGGATGTTGAGTGG + Intronic
967588151 3:191239242-191239264 CCCTGTTATGGAATTTTGAGGGG + Intronic
970416178 4:15859204-15859226 AAGTATTAATGCATCTTGAGTGG - Intergenic
976039390 4:80864349-80864371 CACTATTGTGGCATCCAGAATGG - Intronic
976245252 4:83000761-83000783 AACAATGATGGCATCTTCAGTGG - Intronic
977980710 4:103318133-103318155 CACAAATATGGCATGTGGAGAGG + Intergenic
978479758 4:109175734-109175756 CTCTACTATGGCATTTTGTGTGG - Intronic
980807229 4:137829310-137829332 CAGTATTATAGCATCTTGCTTGG + Intergenic
983093652 4:163537159-163537181 CACTTTAAGGACATCTTGAGAGG + Intronic
986664032 5:10084550-10084572 CCCTATTCCTGCATCTTGAGCGG + Intergenic
988277410 5:29099534-29099556 CACTCTGATGCCATCTTCAGAGG + Intergenic
993875712 5:93304333-93304355 CATTATTATGGCATCTCTTGTGG + Intergenic
1000247278 5:159459146-159459168 CAGTATGCTGGCATTTTGAGTGG + Intergenic
1000635500 5:163639560-163639582 CTCTATTATTGCAACTTAAGTGG + Intergenic
1001406819 5:171482458-171482480 CACCATCATGGCATCTAGAAAGG + Intergenic
1004304900 6:14491450-14491472 CACTAGTATAGTATTTTGAGTGG + Intergenic
1005205468 6:23398315-23398337 CACTATTCTGGAATCCTTAGGGG + Intergenic
1007042560 6:38736934-38736956 AACTATTAGGGAATCTTAAGTGG - Intronic
1008673517 6:53795902-53795924 CACTATCTCGGCATCTTGGGAGG + Intronic
1011820705 6:91250068-91250090 CACTATTATATAACCTTGAGTGG - Intergenic
1012097742 6:94985741-94985763 TAATATTATGGCTTCTGGAGTGG - Intergenic
1012812353 6:103975878-103975900 CACTATAATGGCTTCTTCACAGG + Intergenic
1014511085 6:122323245-122323267 AACAATGATGGCATCTTCAGTGG + Intergenic
1021482772 7:21136098-21136120 AACAATGATGGCATCTTCAGTGG - Intergenic
1022092794 7:27118364-27118386 CATTATTGTGGCATTTGGAGCGG - Intronic
1027740140 7:81991676-81991698 CATTATTATGGTATCATAAGAGG + Intronic
1027808202 7:82857051-82857073 CACAGTGCTGGCATCTTGAGAGG - Intronic
1030757988 7:113313222-113313244 CACTATTAGGGCTTATTGAGAGG + Intergenic
1034091913 7:148371436-148371458 CACGATAATGTCCTCTTGAGTGG + Intronic
1041031373 8:53739015-53739037 CATTATTATGACATTTTTAGTGG - Intronic
1046446375 8:114325756-114325778 AACAATGATGGCATCTTCAGTGG + Intergenic
1046558593 8:115808836-115808858 CACTATTATAGCATTTTGATAGG + Intronic
1047392573 8:124465343-124465365 CACAATTATGGCCACTTGGGAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050804926 9:9663554-9663576 CACTATTATGGGAGTTTGATAGG - Intronic
1053578159 9:39373526-39373548 CAGTATTAGGGAATCTTGAATGG + Intergenic
1053842688 9:42201581-42201603 CAGTATTAGGGAATCTTGAATGG + Intergenic
1054099744 9:60932313-60932335 CAGTATTAGGGAATCTTGAATGG + Intergenic
1054121141 9:61207934-61207956 CAGTATTAGGGAATCTTGAATGG + Intergenic
1054586598 9:66974571-66974593 CAGTATTAGGGAATCTTGAATGG - Intergenic
1059027959 9:110657532-110657554 CACCATTAGGGCAGCTTGACGGG + Intergenic
1060616232 9:125016542-125016564 CATTATTATGGCATTTTAATAGG - Intronic
1061323369 9:129846543-129846565 CACTATTAGGCCATGTTGGGCGG - Intronic
1190772234 X:53524803-53524825 GACAATGATGGCATCTTCAGTGG - Intergenic
1190781249 X:53597876-53597898 GACAATGATGGCATCTTCAGTGG - Intronic
1192031616 X:67519446-67519468 AATTATTATGGCATTTTGATGGG + Intergenic
1193764327 X:85507810-85507832 AATTATTAAGGCATCATGAGAGG + Intergenic
1194114152 X:89874602-89874624 AACGATAATGGCATCTTGAATGG + Intergenic
1198095174 X:133372966-133372988 CACTGTTATGGCAATTGGAGGGG + Intronic
1199046117 X:143175531-143175553 AACTATTAAGGCATCTTGATTGG - Intergenic
1200466893 Y:3529969-3529991 AACGATAATGGCATCTTGAATGG + Intergenic
1201526045 Y:14935595-14935617 CACCATAATGGCATCTTCAAAGG + Intergenic