ID: 918917188

View in Genome Browser
Species Human (GRCh38)
Location 1:190658325-190658347
Sequence TTATCCATCTAGAATTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918917185_918917188 19 Left 918917185 1:190658283-190658305 CCCTGTGTTATTCTTCTAGAGCA No data
Right 918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG No data
918917186_918917188 18 Left 918917186 1:190658284-190658306 CCTGTGTTATTCTTCTAGAGCAT No data
Right 918917188 1:190658325-190658347 TTATCCATCTAGAATTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918917188 Original CRISPR TTATCCATCTAGAATTGTTA TGG Intergenic
No off target data available for this crispr