ID: 918917190

View in Genome Browser
Species Human (GRCh38)
Location 1:190658357-190658379
Sequence TTATCCATCTAGAATTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918917189_918917190 5 Left 918917189 1:190658329-190658351 CCATCTAGAATTGTTATGGTATA No data
Right 918917190 1:190658357-190658379 TTATCCATCTAGAATTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918917190 Original CRISPR TTATCCATCTAGAATTGTTA TGG Intergenic
No off target data available for this crispr