ID: 918918229

View in Genome Browser
Species Human (GRCh38)
Location 1:190671843-190671865
Sequence GACAGCTCTTGGCCTGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918918229_918918232 11 Left 918918229 1:190671843-190671865 CCATTAACAGGCCAAGAGCTGTC No data
Right 918918232 1:190671877-190671899 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330
918918229_918918234 16 Left 918918229 1:190671843-190671865 CCATTAACAGGCCAAGAGCTGTC No data
Right 918918234 1:190671882-190671904 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
918918229_918918233 15 Left 918918229 1:190671843-190671865 CCATTAACAGGCCAAGAGCTGTC No data
Right 918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918918229 Original CRISPR GACAGCTCTTGGCCTGTTAA TGG (reversed) Intergenic
No off target data available for this crispr