ID: 918923874

View in Genome Browser
Species Human (GRCh38)
Location 1:190753476-190753498
Sequence TTGAGGGCACAACTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918923868_918923874 4 Left 918923868 1:190753449-190753471 CCTAAACCTGTAATATTTTTCAG No data
Right 918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG No data
918923867_918923874 18 Left 918923867 1:190753435-190753457 CCTTTGGATTCTAGCCTAAACCT No data
Right 918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG No data
918923869_918923874 -2 Left 918923869 1:190753455-190753477 CCTGTAATATTTTTCAGCTGTTT No data
Right 918923874 1:190753476-190753498 TTGAGGGCACAACTGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918923874 Original CRISPR TTGAGGGCACAACTGGAACA GGG Intergenic
No off target data available for this crispr