ID: 918924031

View in Genome Browser
Species Human (GRCh38)
Location 1:190756726-190756748
Sequence GTGCCCACCCTGACTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918924031_918924033 -3 Left 918924031 1:190756726-190756748 CCATTCTCAGTCAGGGTGGGCAC No data
Right 918924033 1:190756746-190756768 CACCATCTAATCAGCTGCCAGGG 0: 15
1: 37
2: 36
3: 41
4: 173
918924031_918924032 -4 Left 918924031 1:190756726-190756748 CCATTCTCAGTCAGGGTGGGCAC No data
Right 918924032 1:190756745-190756767 GCACCATCTAATCAGCTGCCAGG 0: 21
1: 39
2: 52
3: 44
4: 114
918924031_918924038 28 Left 918924031 1:190756726-190756748 CCATTCTCAGTCAGGGTGGGCAC No data
Right 918924038 1:190756777-190756799 ATAAAGCAGACAGGAGAAGATGG No data
918924031_918924037 19 Left 918924031 1:190756726-190756748 CCATTCTCAGTCAGGGTGGGCAC No data
Right 918924037 1:190756768-190756790 GTGGCTAGAATAAAGCAGACAGG No data
918924031_918924035 0 Left 918924031 1:190756726-190756748 CCATTCTCAGTCAGGGTGGGCAC No data
Right 918924035 1:190756749-190756771 CATCTAATCAGCTGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918924031 Original CRISPR GTGCCCACCCTGACTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr