ID: 918928321

View in Genome Browser
Species Human (GRCh38)
Location 1:190816913-190816935
Sequence GATACTGATGTACCTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918928321_918928327 17 Left 918928321 1:190816913-190816935 CCAGCTGTAGGTACATCAGTATC No data
Right 918928327 1:190816953-190816975 CCATAAAATATACTGGAGGTTGG No data
918928321_918928325 13 Left 918928321 1:190816913-190816935 CCAGCTGTAGGTACATCAGTATC No data
Right 918928325 1:190816949-190816971 AAGACCATAAAATATACTGGAGG No data
918928321_918928324 10 Left 918928321 1:190816913-190816935 CCAGCTGTAGGTACATCAGTATC No data
Right 918928324 1:190816946-190816968 AACAAGACCATAAAATATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918928321 Original CRISPR GATACTGATGTACCTACAGC TGG (reversed) Intergenic
No off target data available for this crispr