ID: 918928325

View in Genome Browser
Species Human (GRCh38)
Location 1:190816949-190816971
Sequence AAGACCATAAAATATACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918928323_918928325 -9 Left 918928323 1:190816935-190816957 CCATGTGGCAAAACAAGACCATA No data
Right 918928325 1:190816949-190816971 AAGACCATAAAATATACTGGAGG No data
918928321_918928325 13 Left 918928321 1:190816913-190816935 CCAGCTGTAGGTACATCAGTATC No data
Right 918928325 1:190816949-190816971 AAGACCATAAAATATACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918928325 Original CRISPR AAGACCATAAAATATACTGG AGG Intergenic
No off target data available for this crispr