ID: 918928327

View in Genome Browser
Species Human (GRCh38)
Location 1:190816953-190816975
Sequence CCATAAAATATACTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918928321_918928327 17 Left 918928321 1:190816913-190816935 CCAGCTGTAGGTACATCAGTATC No data
Right 918928327 1:190816953-190816975 CCATAAAATATACTGGAGGTTGG No data
918928323_918928327 -5 Left 918928323 1:190816935-190816957 CCATGTGGCAAAACAAGACCATA No data
Right 918928327 1:190816953-190816975 CCATAAAATATACTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918928327 Original CRISPR CCATAAAATATACTGGAGGT TGG Intergenic
No off target data available for this crispr