ID: 918928925

View in Genome Browser
Species Human (GRCh38)
Location 1:190827327-190827349
Sequence CTAGGATAGGACCCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918928921_918928925 13 Left 918928921 1:190827291-190827313 CCTGAGGAGTTATGATGACTAAA No data
Right 918928925 1:190827327-190827349 CTAGGATAGGACCCTGAAACAGG No data
918928920_918928925 23 Left 918928920 1:190827281-190827303 CCAAACAGAGCCTGAGGAGTTAT No data
Right 918928925 1:190827327-190827349 CTAGGATAGGACCCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918928925 Original CRISPR CTAGGATAGGACCCTGAAAC AGG Intergenic
No off target data available for this crispr