ID: 918933374

View in Genome Browser
Species Human (GRCh38)
Location 1:190886891-190886913
Sequence TGCCAATCCCCTATTGGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918933374_918933377 -4 Left 918933374 1:190886891-190886913 CCCAAACCAATAGGGGATTGGCA No data
Right 918933377 1:190886910-190886932 GGCAATTAAACTCTACCACAAGG No data
918933374_918933379 30 Left 918933374 1:190886891-190886913 CCCAAACCAATAGGGGATTGGCA No data
Right 918933379 1:190886944-190886966 TGCATAGTTTATTTTAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918933374 Original CRISPR TGCCAATCCCCTATTGGTTT GGG (reversed) Intergenic
No off target data available for this crispr