ID: 918939751

View in Genome Browser
Species Human (GRCh38)
Location 1:190977399-190977421
Sequence CAATTTAGACAGAGAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918939751_918939753 -8 Left 918939751 1:190977399-190977421 CCATTCACTCTCTGTCTAAATTG No data
Right 918939753 1:190977414-190977436 CTAAATTGGCCTTTTTCTCCAGG No data
918939751_918939754 -7 Left 918939751 1:190977399-190977421 CCATTCACTCTCTGTCTAAATTG No data
Right 918939754 1:190977415-190977437 TAAATTGGCCTTTTTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918939751 Original CRISPR CAATTTAGACAGAGAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr