ID: 918952667

View in Genome Browser
Species Human (GRCh38)
Location 1:191160143-191160165
Sequence GGCAAATGGGCTTGGTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918952659_918952667 17 Left 918952659 1:191160103-191160125 CCATGCAATAGCAAAAACACAAA No data
Right 918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG No data
918952662_918952667 -9 Left 918952662 1:191160129-191160151 CCAATTTAAAAATGGGCAAATGG No data
Right 918952667 1:191160143-191160165 GGCAAATGGGCTTGGTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918952667 Original CRISPR GGCAAATGGGCTTGGTGCGG TGG Intergenic
No off target data available for this crispr