ID: 918953148

View in Genome Browser
Species Human (GRCh38)
Location 1:191167188-191167210
Sequence CAGAGTTTTCACATTTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918953148_918953149 -3 Left 918953148 1:191167188-191167210 CCTACTGAAATGTGAAAACTCTG No data
Right 918953149 1:191167208-191167230 CTGTCAGTTATATAGAAAATTGG No data
918953148_918953150 17 Left 918953148 1:191167188-191167210 CCTACTGAAATGTGAAAACTCTG No data
Right 918953150 1:191167228-191167250 TGGAAACAATTATTCTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918953148 Original CRISPR CAGAGTTTTCACATTTCAGT AGG (reversed) Intergenic
No off target data available for this crispr