ID: 918958242

View in Genome Browser
Species Human (GRCh38)
Location 1:191237947-191237969
Sequence AGTTGTCTTCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918958242_918958249 22 Left 918958242 1:191237947-191237969 CCTGCCATCTTCTGAAGACAACT No data
Right 918958249 1:191237992-191238014 CTTGGCCTGTTACTGGCCTTTGG No data
918958242_918958248 15 Left 918958242 1:191237947-191237969 CCTGCCATCTTCTGAAGACAACT No data
Right 918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
918958242_918958250 25 Left 918958242 1:191237947-191237969 CCTGCCATCTTCTGAAGACAACT No data
Right 918958250 1:191237995-191238017 GGCCTGTTACTGGCCTTTGGTGG No data
918958242_918958246 4 Left 918958242 1:191237947-191237969 CCTGCCATCTTCTGAAGACAACT No data
Right 918958246 1:191237974-191237996 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918958242 Original CRISPR AGTTGTCTTCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr