ID: 918968955

View in Genome Browser
Species Human (GRCh38)
Location 1:191387930-191387952
Sequence AAGTACAAAGAGAAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918968953_918968955 -9 Left 918968953 1:191387916-191387938 CCTTGGAAGAACTTAAGTACAAA No data
Right 918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG No data
918968951_918968955 24 Left 918968951 1:191387883-191387905 CCAGAGCGTTGGCGAAATTGGCA No data
Right 918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG No data
918968950_918968955 25 Left 918968950 1:191387882-191387904 CCCAGAGCGTTGGCGAAATTGGC No data
Right 918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG No data
918968948_918968955 30 Left 918968948 1:191387877-191387899 CCTCACCCAGAGCGTTGGCGAAA No data
Right 918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918968955 Original CRISPR AAGTACAAAGAGAAGTGGTG TGG Intergenic
No off target data available for this crispr