ID: 918969559

View in Genome Browser
Species Human (GRCh38)
Location 1:191396971-191396993
Sequence TTTCAGCAGCACCCCGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918969559_918969564 14 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969564 1:191397008-191397030 GTGGAAGCAACTTTGGAACTGGG 0: 779
1: 1528
2: 2091
3: 1649
4: 1169
918969559_918969562 7 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969562 1:191397001-191397023 TGAAAATGTGGAAGCAACTTTGG 0: 508
1: 1039
2: 1853
3: 1876
4: 1834
918969559_918969560 -5 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969560 1:191396989-191397011 TGAAAAGAGACCTGAAAATGTGG No data
918969559_918969565 21 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969565 1:191397015-191397037 CAACTTTGGAACTGGGTAATAGG 0: 147
1: 1070
2: 1775
3: 2037
4: 1644
918969559_918969566 27 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969566 1:191397021-191397043 TGGAACTGGGTAATAGGTAGAGG No data
918969559_918969563 13 Left 918969559 1:191396971-191396993 CCAAGAGCGGGGTGCTGCTGAAA No data
Right 918969563 1:191397007-191397029 TGTGGAAGCAACTTTGGAACTGG 0: 788
1: 1562
2: 2072
3: 1660
4: 1181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918969559 Original CRISPR TTTCAGCAGCACCCCGCTCT TGG (reversed) Intergenic
No off target data available for this crispr