ID: 918974891

View in Genome Browser
Species Human (GRCh38)
Location 1:191471141-191471163
Sequence AGCAGGAGCTTCTAGGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918974891_918974894 -1 Left 918974891 1:191471141-191471163 CCTATGACCTAGAAGCTCCTGCT No data
Right 918974894 1:191471163-191471185 TTCCAGTTGTTCCACATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918974891 Original CRISPR AGCAGGAGCTTCTAGGTCAT AGG (reversed) Intergenic
No off target data available for this crispr