ID: 918976113

View in Genome Browser
Species Human (GRCh38)
Location 1:191488628-191488650
Sequence CAATATACAATTGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918976107_918976113 12 Left 918976107 1:191488593-191488615 CCTCCTACCTCATTCACACACAC No data
Right 918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG No data
918976108_918976113 9 Left 918976108 1:191488596-191488618 CCTACCTCATTCACACACACGCA No data
Right 918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG No data
918976109_918976113 5 Left 918976109 1:191488600-191488622 CCTCATTCACACACACGCATACC No data
Right 918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG No data
918976106_918976113 13 Left 918976106 1:191488592-191488614 CCCTCCTACCTCATTCACACACA No data
Right 918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918976113 Original CRISPR CAATATACAATTGTGGAGCT GGG Intergenic
No off target data available for this crispr