ID: 918977377

View in Genome Browser
Species Human (GRCh38)
Location 1:191507176-191507198
Sequence TGCCATGCCATTAGTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918977377_918977380 -7 Left 918977377 1:191507176-191507198 CCCTGCTCACTAATGGCATGGCA No data
Right 918977380 1:191507192-191507214 CATGGCATGGCATCTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918977377 Original CRISPR TGCCATGCCATTAGTGAGCA GGG (reversed) Intergenic
No off target data available for this crispr