ID: 918980234

View in Genome Browser
Species Human (GRCh38)
Location 1:191547982-191548004
Sequence GGGAATGTATTTTCAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918980234_918980243 30 Left 918980234 1:191547982-191548004 CCTTTATTTGAAAATACATTCCC No data
Right 918980243 1:191548035-191548057 CAAATGCTGGCAAGTGGGCCAGG No data
918980234_918980239 24 Left 918980234 1:191547982-191548004 CCTTTATTTGAAAATACATTCCC No data
Right 918980239 1:191548029-191548051 TCCCTTCAAATGCTGGCAAGTGG No data
918980234_918980241 25 Left 918980234 1:191547982-191548004 CCTTTATTTGAAAATACATTCCC No data
Right 918980241 1:191548030-191548052 CCCTTCAAATGCTGGCAAGTGGG No data
918980234_918980238 17 Left 918980234 1:191547982-191548004 CCTTTATTTGAAAATACATTCCC No data
Right 918980238 1:191548022-191548044 TCAATTCTCCCTTCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918980234 Original CRISPR GGGAATGTATTTTCAAATAA AGG (reversed) Intergenic
No off target data available for this crispr