ID: 918984507

View in Genome Browser
Species Human (GRCh38)
Location 1:191606905-191606927
Sequence GACTCTCTCAGTATTAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918984507_918984512 20 Left 918984507 1:191606905-191606927 CCTGAGTTAATACTGAGAGAGTC No data
Right 918984512 1:191606948-191606970 GACTGAGGTCCTTTAACAAAAGG No data
918984507_918984514 29 Left 918984507 1:191606905-191606927 CCTGAGTTAATACTGAGAGAGTC No data
Right 918984514 1:191606957-191606979 CCTTTAACAAAAGGCCTTGAAGG No data
918984507_918984510 5 Left 918984507 1:191606905-191606927 CCTGAGTTAATACTGAGAGAGTC No data
Right 918984510 1:191606933-191606955 GGTTTCACCTTAACTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918984507 Original CRISPR GACTCTCTCAGTATTAACTC AGG (reversed) Intergenic
No off target data available for this crispr