ID: 918984512

View in Genome Browser
Species Human (GRCh38)
Location 1:191606948-191606970
Sequence GACTGAGGTCCTTTAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918984507_918984512 20 Left 918984507 1:191606905-191606927 CCTGAGTTAATACTGAGAGAGTC No data
Right 918984512 1:191606948-191606970 GACTGAGGTCCTTTAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918984512 Original CRISPR GACTGAGGTCCTTTAACAAA AGG Intergenic
No off target data available for this crispr