ID: 919000550

View in Genome Browser
Species Human (GRCh38)
Location 1:191826462-191826484
Sequence ATGCTGATTCAGAGCTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919000542_919000550 25 Left 919000542 1:191826414-191826436 CCTGGACCCATGAATCCTGGCTA 0: 73
1: 155
2: 223
3: 212
4: 297
Right 919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG No data
919000545_919000550 19 Left 919000545 1:191826420-191826442 CCCATGAATCCTGGCTATGGGAG 0: 77
1: 235
2: 215
3: 154
4: 212
Right 919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG No data
919000547_919000550 10 Left 919000547 1:191826429-191826451 CCTGGCTATGGGAGAAACAGTAC 0: 151
1: 207
2: 173
3: 141
4: 198
Right 919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG No data
919000546_919000550 18 Left 919000546 1:191826421-191826443 CCATGAATCCTGGCTATGGGAGA 0: 129
1: 151
2: 122
3: 124
4: 261
Right 919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919000550 Original CRISPR ATGCTGATTCAGAGCTTACA TGG Intergenic
No off target data available for this crispr