ID: 919001566

View in Genome Browser
Species Human (GRCh38)
Location 1:191838353-191838375
Sequence ATCTGATGGTGCCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919001561_919001566 6 Left 919001561 1:191838324-191838346 CCGGAAAGCAGGCTTTCCCCAGA No data
Right 919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG No data
919001559_919001566 17 Left 919001559 1:191838313-191838335 CCATCTGTGAACCGGAAAGCAGG No data
Right 919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG No data
919001563_919001566 -10 Left 919001563 1:191838340-191838362 CCCCAGACACTAAATCTGATGGT No data
Right 919001566 1:191838353-191838375 ATCTGATGGTGCCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919001566 Original CRISPR ATCTGATGGTGCCTTGATTT TGG Intergenic
No off target data available for this crispr