ID: 919004862

View in Genome Browser
Species Human (GRCh38)
Location 1:191884407-191884429
Sequence CTGGTTCTTTCATGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919004862_919004871 15 Left 919004862 1:191884407-191884429 CCCCCAAAACATGAAAGAACCAG No data
Right 919004871 1:191884445-191884467 CAGAAGTGCTCCTGGATAAGGGG No data
919004862_919004870 14 Left 919004862 1:191884407-191884429 CCCCCAAAACATGAAAGAACCAG No data
Right 919004870 1:191884444-191884466 TCAGAAGTGCTCCTGGATAAGGG No data
919004862_919004868 7 Left 919004862 1:191884407-191884429 CCCCCAAAACATGAAAGAACCAG No data
Right 919004868 1:191884437-191884459 GGTTTTGTCAGAAGTGCTCCTGG No data
919004862_919004869 13 Left 919004862 1:191884407-191884429 CCCCCAAAACATGAAAGAACCAG No data
Right 919004869 1:191884443-191884465 GTCAGAAGTGCTCCTGGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919004862 Original CRISPR CTGGTTCTTTCATGTTTTGG GGG (reversed) Intergenic
No off target data available for this crispr