ID: 919004868

View in Genome Browser
Species Human (GRCh38)
Location 1:191884437-191884459
Sequence GGTTTTGTCAGAAGTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919004862_919004868 7 Left 919004862 1:191884407-191884429 CCCCCAAAACATGAAAGAACCAG No data
Right 919004868 1:191884437-191884459 GGTTTTGTCAGAAGTGCTCCTGG No data
919004865_919004868 4 Left 919004865 1:191884410-191884432 CCAAAACATGAAAGAACCAGACA No data
Right 919004868 1:191884437-191884459 GGTTTTGTCAGAAGTGCTCCTGG No data
919004863_919004868 6 Left 919004863 1:191884408-191884430 CCCCAAAACATGAAAGAACCAGA No data
Right 919004868 1:191884437-191884459 GGTTTTGTCAGAAGTGCTCCTGG No data
919004864_919004868 5 Left 919004864 1:191884409-191884431 CCCAAAACATGAAAGAACCAGAC No data
Right 919004868 1:191884437-191884459 GGTTTTGTCAGAAGTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919004868 Original CRISPR GGTTTTGTCAGAAGTGCTCC TGG Intergenic
No off target data available for this crispr