ID: 919005354

View in Genome Browser
Species Human (GRCh38)
Location 1:191891644-191891666
Sequence CATTGTAGACACACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919005349_919005354 16 Left 919005349 1:191891605-191891627 CCTCTCCAGTCAGTGAAGCTGTG No data
Right 919005354 1:191891644-191891666 CATTGTAGACACACTGAGGATGG No data
919005352_919005354 11 Left 919005352 1:191891610-191891632 CCAGTCAGTGAAGCTGTGGGAAA No data
Right 919005354 1:191891644-191891666 CATTGTAGACACACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919005354 Original CRISPR CATTGTAGACACACTGAGGA TGG Intergenic
No off target data available for this crispr