ID: 919011057

View in Genome Browser
Species Human (GRCh38)
Location 1:191963591-191963613
Sequence CTAAATTTAACTAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919011057_919011061 16 Left 919011057 1:191963591-191963613 CCTGGTTCCCTAGTTAAATTTAG No data
Right 919011061 1:191963630-191963652 CTAGTCAAATTTTAATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919011057 Original CRISPR CTAAATTTAACTAGGGAACC AGG (reversed) Intergenic
No off target data available for this crispr