ID: 919012392

View in Genome Browser
Species Human (GRCh38)
Location 1:191982746-191982768
Sequence GTATGCTACCCTTGAGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919012392_919012394 -2 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012394 1:191982767-191982789 ACCATGGCACCAGTGTTAGCAGG No data
919012392_919012404 28 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012404 1:191982797-191982819 GGGCCAATTTTGGGGCCTCCAGG No data
919012392_919012402 20 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012402 1:191982789-191982811 GTCCAGGTGGGCCAATTTTGGGG No data
919012392_919012400 18 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012400 1:191982787-191982809 AGGTCCAGGTGGGCCAATTTTGG No data
919012392_919012401 19 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012401 1:191982788-191982810 GGTCCAGGTGGGCCAATTTTGGG No data
919012392_919012396 4 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG No data
919012392_919012398 7 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012398 1:191982776-191982798 CCAGTGTTAGCAGGTCCAGGTGG No data
919012392_919012399 8 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012399 1:191982777-191982799 CAGTGTTAGCAGGTCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919012392 Original CRISPR GTATGCTACCCTTGAGTCCA AGG (reversed) Intergenic
No off target data available for this crispr