ID: 919012396

View in Genome Browser
Species Human (GRCh38)
Location 1:191982773-191982795
Sequence GCACCAGTGTTAGCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919012392_919012396 4 Left 919012392 1:191982746-191982768 CCTTGGACTCAAGGGTAGCATAC No data
Right 919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919012396 Original CRISPR GCACCAGTGTTAGCAGGTCC AGG Intergenic
No off target data available for this crispr