ID: 919020955

View in Genome Browser
Species Human (GRCh38)
Location 1:192105227-192105249
Sequence TGCCCTTCCAAGATTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919020952_919020955 17 Left 919020952 1:192105187-192105209 CCAGTGAAGCAGAAAGCTCTAAT No data
Right 919020955 1:192105227-192105249 TGCCCTTCCAAGATTGTGTCTGG No data
919020950_919020955 21 Left 919020950 1:192105183-192105205 CCTCCCAGTGAAGCAGAAAGCTC No data
Right 919020955 1:192105227-192105249 TGCCCTTCCAAGATTGTGTCTGG No data
919020951_919020955 18 Left 919020951 1:192105186-192105208 CCCAGTGAAGCAGAAAGCTCTAA No data
Right 919020955 1:192105227-192105249 TGCCCTTCCAAGATTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919020955 Original CRISPR TGCCCTTCCAAGATTGTGTC TGG Intergenic
No off target data available for this crispr