ID: 919025971

View in Genome Browser
Species Human (GRCh38)
Location 1:192170928-192170950
Sequence TCTCAAATGCAGGTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919025971 Original CRISPR TCTCAAATGCAGGTGGTGAA AGG Intronic
902185002 1:14718355-14718377 TCTGAAAAGCAGGTGATTAAGGG - Intronic
903101421 1:21034479-21034501 TCACAAATACAGCTGTTGAATGG - Intronic
903603444 1:24558121-24558143 TCTAAAGTGCAGGTGGAGACTGG + Intronic
906355076 1:45098367-45098389 TCTCAAATTGAGGTGGTGTTAGG - Intronic
908499958 1:64733281-64733303 TCTCAGATGCAGGAACTGAAGGG + Intergenic
909966744 1:81922149-81922171 TTTCAAAAGCTGGTGGAGAAGGG + Intronic
916423242 1:164656010-164656032 CTTCAATTGCAGGTGGAGAATGG + Intronic
917594417 1:176514528-176514550 AGTCAAATCCATGTGGTGAAGGG - Intronic
918006091 1:180543351-180543373 TCTCAAAATCAGGTGATTAATGG - Intergenic
918585300 1:186180363-186180385 TCTAAAATGAAGGTTGAGAATGG - Intronic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
920196540 1:204230992-204231014 TCTAAAATCCAGGTGGTGGCAGG - Intronic
920384155 1:205556202-205556224 TCACAAAGGAAGGTGGTGAGGGG + Intergenic
920499336 1:206476586-206476608 TTTCACCTGCAGGCGGTGAAAGG + Intronic
921709592 1:218360466-218360488 TCTCACATGCACGTAGTGAGGGG + Intronic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
922199593 1:223390724-223390746 TCCCAAATGCAGCTGGAGAAAGG - Intergenic
922970309 1:229730495-229730517 TCTCAGATCCAGGTGATGGATGG + Intergenic
1063047116 10:2403634-2403656 TCTCAAATGCATGAGCTCAAGGG - Intergenic
1063187624 10:3665310-3665332 TCCCAAATGCAAGGGGTGAGTGG - Intergenic
1063245385 10:4212515-4212537 TCTCAGCTGCATGTGGTGGAGGG + Intergenic
1064745079 10:18470777-18470799 TCTCAAATGCTGGGTGTGGATGG + Intronic
1066709288 10:38216250-38216272 TCTTAAATGCATTTGGTGAGGGG + Intergenic
1067550760 10:47234227-47234249 TCTTAACTTCAGGTGGAGAAAGG + Intergenic
1069299991 10:66895623-66895645 TATCAATTATAGGTGGTGAATGG - Intronic
1070610612 10:77929758-77929780 TCTGAAATCCAGGTGTTGGAGGG - Intergenic
1072004013 10:91224800-91224822 TATGAAATGGAGGTGGAGAAGGG + Intronic
1074099812 10:110345901-110345923 TCTCTATTGCAGGAGGGGAAAGG + Intergenic
1075439834 10:122471182-122471204 CCACAAATGCTGGTGGAGAAAGG - Intronic
1076498692 10:130917121-130917143 GCTGAAATGCAGGTGGTGGCAGG - Intergenic
1077522226 11:3043216-3043238 TCTCAGATGCAGGTTGTGTAAGG - Intronic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1078085107 11:8229284-8229306 TTTTAAATGCAGGTGTTAAAAGG + Intronic
1078576656 11:12508562-12508584 TCTGAAATGGGGGTGGGGAAAGG - Exonic
1080343675 11:31297212-31297234 TCTCAAAGGCTGGGGGTGAGTGG + Intronic
1081151459 11:39638149-39638171 TCTAAAATACAGGTGATAAATGG + Intergenic
1082249065 11:49960110-49960132 ACTCAAGTGCTGGTGGTGATAGG - Intergenic
1083177461 11:60960087-60960109 TCTAAAATGAAGGTGTTGACAGG - Intergenic
1083709017 11:64536215-64536237 TCTGTAATGCAGGCGGTGAAGGG - Intergenic
1084188711 11:67489171-67489193 TCTCAGATGGTGGTGGGGAAGGG + Intronic
1085527729 11:77173866-77173888 CCTCTAATGCAGGGGGTGCAGGG + Intronic
1085856440 11:80181414-80181436 TCTCACATGCTGGTGGGGTAAGG + Intergenic
1086487813 11:87327418-87327440 GCTCAAATGCAGATGGTTAATGG - Intergenic
1087016921 11:93562891-93562913 TCTCAAAAGCAGGAGGGGTAAGG - Intergenic
1088121704 11:106377788-106377810 AATCAAATGCAGATAGTGAAGGG + Intergenic
1089439448 11:118502998-118503020 TCTCAAATGGAGGTGTGGGAAGG - Exonic
1090249583 11:125242074-125242096 TGTGAAATGAAGGTGATGAATGG - Intronic
1095514713 12:42993170-42993192 TCTGAAATGCAGGAGATGTATGG - Intergenic
1097362558 12:58673962-58673984 TCTCAAAAGCGGGTGGAGATAGG - Intronic
1098732238 12:74051719-74051741 TCTCAACTCCAGGTGTGGAATGG - Intergenic
1101392044 12:104310045-104310067 TATCAGATGTAGGGGGTGAAAGG - Intronic
1104002998 12:124872365-124872387 TCTCAACAGCAGCTGGAGAAAGG + Intronic
1105612891 13:21984813-21984835 TCCTAAATGCAGTTGATGAAAGG - Intergenic
1105956555 13:25288233-25288255 TCTCAAATGGTGGTGGTGGGGGG + Intergenic
1106432937 13:29698968-29698990 TCTCAAATGCTGGTTGTGGTAGG - Intergenic
1107237659 13:38192070-38192092 TTTAGAATGGAGGTGGTGAATGG + Intergenic
1110779450 13:79447903-79447925 TCTCTAATGCCGGTAATGAATGG + Intergenic
1111181733 13:84677614-84677636 TCTCAAATGCAGCCTGAGAAAGG - Intergenic
1111350840 13:87028947-87028969 TATCAATTGGAGATGGTGAAAGG + Intergenic
1111763856 13:92500784-92500806 TATCTAAGGCAGGTGGTGAGTGG - Intronic
1114983606 14:28196327-28196349 TCTCAAGTGCTGTTGGTGAAAGG + Intergenic
1115569001 14:34649497-34649519 TCCCAGATGAAGCTGGTGAAGGG - Intergenic
1115917662 14:38334677-38334699 TTTCAAATGCAGGTGGATACTGG + Intergenic
1117677298 14:58167554-58167576 TCTGGACTGCAGGTGGAGAATGG - Intronic
1118485718 14:66212914-66212936 TCTCAAAGGCAGTTTGGGAAAGG + Intergenic
1119611494 14:76066887-76066909 TCTCCAAGGCTGGTGGTGGAAGG - Intronic
1123577787 15:21690247-21690269 TCACACAAGCTGGTGGTGAAGGG - Intergenic
1123614411 15:22132728-22132750 TCACACAAGCTGGTGGTGAAGGG - Intergenic
1125922003 15:43530500-43530522 TGTCAAATGCTGGTATTGAATGG + Exonic
1131724844 15:95210135-95210157 TTTAAAATGCAGGTGTTGAGAGG + Intergenic
1202986656 15_KI270727v1_random:424492-424514 TCACACAAGCTGGTGGTGAAGGG - Intergenic
1133476730 16:6129797-6129819 TATAAAATGCAGGGGATGAATGG + Intronic
1134824448 16:17273319-17273341 TTACAAATGCAGGCGGGGAATGG - Intronic
1135669869 16:24366102-24366124 CCTCAAATGCAGCTGGGAAAGGG - Intergenic
1135865818 16:26100927-26100949 GCTCAAAGGCAGGAGATGAAAGG + Intronic
1135867137 16:26114141-26114163 GCTCAGATGCAGGTGGTGTGGGG + Intronic
1137586397 16:49666321-49666343 TGTCGAAGGCAGGTGGGGAATGG - Intronic
1138026913 16:53529072-53529094 GCTCAAGTGCAGGTGCTGAGTGG + Intergenic
1140919224 16:79521399-79521421 TCTCAAATGCAGATGAGGAAAGG + Intergenic
1141048026 16:80734736-80734758 TAGGAAATGCAGGTGTTGAATGG + Intronic
1141844623 16:86598974-86598996 TCTCAAAAGCAGGTGGAGGCAGG - Intergenic
1144243770 17:13341376-13341398 TCTCAAATCCAGATTGTGATGGG + Intergenic
1144544246 17:16177802-16177824 TTTCAATTGGTGGTGGTGAATGG - Intronic
1146523712 17:33547744-33547766 TCTCAGATGCAGGTGTAGCATGG - Intronic
1147043438 17:37735412-37735434 TCCCAACTGCAGGTGGTGTTGGG + Intronic
1148782866 17:50131247-50131269 GCTCAAGAGCAAGTGGTGAAAGG + Intergenic
1148947638 17:51278544-51278566 TCTCCAAAGCAGTTGGTGACTGG - Intronic
1149169510 17:53792550-53792572 TGACAAATGCAGGGAGTGAAAGG + Intergenic
1149690042 17:58567873-58567895 GCTGAAATGGAGGAGGTGAATGG + Intronic
1152624739 17:81383087-81383109 CCTCAAATGCAGGTGGGGTGGGG - Intergenic
1153449249 18:5208602-5208624 TTTCAAAAGCAGGTGGTATAAGG - Intergenic
1155542324 18:26881555-26881577 TCTCATTTGAAGGTGGTTAAAGG + Intergenic
1156720725 18:40066697-40066719 TCTCCACAGGAGGTGGTGAATGG + Intergenic
1159643890 18:70894592-70894614 TGTTAAATGCAGGTTGGGAATGG + Intergenic
1161900317 19:7113865-7113887 TCTCCAGGGCAGGTGGAGAAAGG + Intronic
1164822489 19:31260875-31260897 TTAAAAATGCATGTGGTGAATGG - Intergenic
1165577059 19:36829032-36829054 TGTCAAAAGGAGGTGGTAAAAGG + Intronic
925275737 2:2646953-2646975 TCCCACCTGCAGGTGCTGAAAGG - Intergenic
929931932 2:46263911-46263933 TCTCAAATTCACCAGGTGAAAGG + Intergenic
930008623 2:46917094-46917116 TCTCAGATGAAGGTGGGAAAAGG - Intronic
930086725 2:47503161-47503183 TCTCCAATGAAGGAGGGGAATGG - Intronic
931711561 2:64992345-64992367 TGTCAGAAGCAGGAGGTGAAGGG - Intronic
931802010 2:65767734-65767756 AATCAAATCCAGGTGGTTAATGG + Intergenic
932446005 2:71782057-71782079 TCCAAAATGCTGGTGGTGAAGGG + Intergenic
932954231 2:76332622-76332644 TCTCAAAGGAGGGTGGTGAGGGG + Intergenic
932954238 2:76332651-76332673 TCTCAAAGGAGGGTGGTGAGGGG + Intergenic
932968703 2:76511192-76511214 TCTCAAGAGCAGGTGGGGACTGG + Intergenic
935099457 2:99978978-99979000 GATCAAAGGCAGGTGGTGGAAGG + Intronic
935131107 2:100261536-100261558 TCTCAGAAGCAGGTGGTCCAGGG + Intergenic
936738143 2:115471485-115471507 TCTCAGAAGCCGGTGGTGGAAGG - Intronic
938329795 2:130441536-130441558 TCTGAGATGCAGGTGGTGCCAGG + Intergenic
938360151 2:130679967-130679989 TCTGAGATGCAGGTGGTGCCAGG - Intergenic
938436554 2:131286674-131286696 TCTGAGATGCAGGTGGTGCCAGG - Intronic
938662750 2:133504430-133504452 CCTTAAATGCATGTGCTGAATGG - Intronic
939253625 2:139715457-139715479 TCTCAAAAGCAAGAGGAGAAAGG + Intergenic
939283867 2:140102448-140102470 TCTGAAATCCAGGTGGTGGCAGG - Intergenic
940551772 2:155167823-155167845 TCAAAAATGCTGGAGGTGAAGGG - Intergenic
940865778 2:158816703-158816725 TCTCAACTGGAGGTGCAGAATGG - Intronic
941584330 2:167337977-167337999 TCTGAAAACCAAGTGGTGAATGG + Intergenic
941696270 2:168554606-168554628 TCCCAGATGAAGGTGTTGAATGG - Intronic
941727078 2:168872481-168872503 TCTCCAGTGAAGGTGGTCAAAGG + Intronic
942594833 2:177583092-177583114 TCTCAAATGCAGGTCTGGCAGGG + Intergenic
942947749 2:181687996-181688018 TTTCAAACTTAGGTGGTGAAAGG + Intergenic
944875094 2:203955728-203955750 TTTAAAATGCAGTTGCTGAAAGG + Exonic
945805370 2:214483935-214483957 TCTCAAATGAAGGTGTTGCAAGG + Intronic
947202724 2:227629289-227629311 ACTCAAATGCAGGTTGTGTGTGG - Intronic
947351265 2:229248019-229248041 TCTCAAATGCATGTGGGTAAAGG - Intronic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
1169190425 20:3655506-3655528 TCTGAAATGCAGGTGTTGCCAGG + Intergenic
1169481476 20:5985947-5985969 TCTCAATAGCTGGTGGGGAATGG - Exonic
1169876233 20:10299905-10299927 TGTCAAGTGGAGGTGGTGAAGGG + Intronic
1170641364 20:18156615-18156637 TCTGAAATCCAGGTGTTGATAGG + Intronic
1170930017 20:20761273-20761295 ACTAAAATGCAGTTGGTAAAGGG + Intergenic
1171394133 20:24820136-24820158 TCTCAAAGGCAGGTGACGAGGGG + Intergenic
1171453102 20:25249644-25249666 TCTAAAATGGAGATGGTAAAAGG + Intronic
1172924058 20:38514292-38514314 TCTCAAAGGCAGGAGGAAAAAGG - Intronic
1173227611 20:41171110-41171132 TACCAAATGCACTTGGTGAAAGG - Intronic
1174433509 20:50488670-50488692 TCTGAAATGCAGATGGTAATAGG + Intergenic
1175661371 20:60815910-60815932 CCTCAAATGAAGGTGGTGGTGGG - Intergenic
1175664577 20:60847539-60847561 TCACAAATGCAGGTGGGAAATGG - Intergenic
1178272525 21:31204969-31204991 TCTCAAATATAGGCAGTGAAAGG - Intronic
1178811559 21:35886951-35886973 AGTCAAATGCCGGTGGTTAAGGG + Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1182327153 22:29522017-29522039 TCTCCATTTGAGGTGGTGAAGGG - Intronic
1182675936 22:32040037-32040059 TCTCAAATGATGGGTGTGAAGGG - Intergenic
1182793080 22:32969206-32969228 TCTCCAGTGCAGGTGCTGAATGG + Intronic
949854254 3:8445837-8445859 CATCAAATGCAGGTGGTCCAAGG - Intergenic
950366474 3:12488752-12488774 TCTCAAAATCAGACGGTGAAGGG - Intronic
950576950 3:13837766-13837788 GCTCAGATGGAGGTGGTCAAGGG - Intronic
952068450 3:29602215-29602237 TGTCAAATGCATGTGGAAAATGG - Intronic
953201494 3:40781922-40781944 TCTGAGGAGCAGGTGGTGAATGG + Intergenic
953227983 3:41038012-41038034 TCTGAAATGCAGGTGGGGTGGGG + Intergenic
954089904 3:48275960-48275982 CCTCTAATGTAGGTGGAGAAAGG - Intronic
954286870 3:49625486-49625508 ACACAAATGCTGGTGGTCAAGGG - Intronic
957909293 3:86601668-86601690 TCTAAAATCCAGGTGTTGGAGGG + Intergenic
959183706 3:103015024-103015046 TCTAGAATCCAGGTGTTGAATGG + Intergenic
959938492 3:112055382-112055404 CCTCAAAGGTAGGTGGTGAGGGG + Intronic
960419338 3:117424802-117424824 TTTCAAATGCAGATGGTCACTGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962992176 3:140588005-140588027 TCTCAAATGCACATGGTAAATGG + Intergenic
965399322 3:168198774-168198796 TCTAAAATTCAGGTGGGGAATGG - Intergenic
965968349 3:174523891-174523913 TTTAAAATTCAGGTTGTGAATGG + Intronic
967700422 3:192585761-192585783 TCTTGAATGGAGGTGGGGAAGGG + Intronic
968688505 4:1977240-1977262 TCTGAAATGCGGGTGCTGGAAGG - Intronic
969460427 4:7326096-7326118 GCTCAGAGGCAGGTGGTGAGGGG + Intronic
969885079 4:10208191-10208213 TCCCAACTGGAGGTGGTGGATGG - Intergenic
970497397 4:16640514-16640536 TCTCAGATCCATGGGGTGAAGGG + Intronic
970581203 4:17475834-17475856 TTTAAAATGCAGGTGGTAATTGG - Intronic
971898330 4:32625197-32625219 TCTCAGATGCAGGTTGAAAAGGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978227909 4:106360843-106360865 TCTGAAATGAAGGTGTTGTAAGG - Intergenic
980087731 4:128409303-128409325 TCTCAAATGCTGGTTGTGCTAGG + Intergenic
980758456 4:137196581-137196603 TGTCAAATACTGGTGGTGAAAGG + Intergenic
982109391 4:152040092-152040114 TCCCAAAACCAGGTGCTGAAAGG + Intergenic
984053835 4:174900905-174900927 TCTGAAATCCAGGAGTTGAAAGG - Intronic
985717553 5:1471207-1471229 TCTCAAATGCAGGTCTTGGCAGG - Intronic
985889005 5:2701202-2701224 CCTCAAATGCACATTGTGAAAGG - Intergenic
986768295 5:10948249-10948271 ACTCAAATGCAGGTGGAAGAAGG + Intergenic
987618982 5:20314389-20314411 GCTCAAATGTATATGGTGAAAGG - Intronic
988433822 5:31150224-31150246 TGGAAAATGCGGGTGGTGAAGGG - Intergenic
989283449 5:39671397-39671419 TCTCAAATGCATGTGAAGAGAGG + Intergenic
990682020 5:58255409-58255431 TCCCAAATGCAGTTGTGGAAAGG + Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
996923667 5:128798082-128798104 TCTCACACACAGGTGCTGAATGG + Intronic
997630838 5:135367884-135367906 TCCCAAATGCATATGTTGAAAGG + Intronic
999118126 5:149182944-149182966 TATCAAATGAGGGTGGTCAAAGG - Intronic
1001444824 5:171775109-171775131 TGTCAAATGAACGTGGTGGAGGG - Intergenic
1001609967 5:172992498-172992520 TGTCAAAGGCAGGGGGTGAGAGG - Intronic
1001768789 5:174276753-174276775 TCTCAAATGCAGGTGACGGTGGG + Intergenic
1001870644 5:175151329-175151351 TCTGACATGCAGCTGGTCAATGG + Intergenic
1002015924 5:176322695-176322717 CCTGAAATGCAGGAAGTGAAGGG - Intronic
1004073265 6:12321565-12321587 CCTCGAATGAAGGTGGAGAAAGG - Intergenic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1006422256 6:33942384-33942406 TCTCAAATGCAGGGGCAGACAGG + Intergenic
1007265577 6:40593277-40593299 TCTCAAAGGGATGTGGAGAATGG + Intergenic
1011553337 6:88549499-88549521 TCTCAGATGAAGGTGGAGACTGG - Intergenic
1012020044 6:93906692-93906714 TTTAAAATGCAGGTGGTTATGGG - Intergenic
1013567371 6:111380691-111380713 ACTCTAATGCAGGTGGTCCAAGG - Intronic
1015574202 6:134653599-134653621 TCCCAAATGCAGCTGGTGCCAGG + Intergenic
1018244485 6:161809247-161809269 CCTCAAAGGCAGGGGGGGAAGGG + Intronic
1021062119 7:16126210-16126232 TCTTTAATGCAGGTAGGGAATGG - Intronic
1022184563 7:27954580-27954602 ACTCAAATGCAGGTGGCTTAGGG + Intronic
1023376084 7:39556879-39556901 TGACAAATGCAGGGGGTGAAAGG + Intergenic
1025042903 7:55663150-55663172 TCTTAAAGGCAGGTAGAGAAAGG + Intergenic
1027888423 7:83938744-83938766 TCTGAAAGCCAGGTGCTGAAAGG + Intergenic
1029185758 7:98737291-98737313 GCTCAAATGCAGGTGTTATATGG - Intergenic
1030660697 7:112216051-112216073 TCTCAAATGAAGGAGGAGAAGGG + Intronic
1030673561 7:112363011-112363033 TCTAAAATGAAGTTGGTGAGAGG + Intergenic
1030883660 7:114913141-114913163 TCTGAAATTGAGGTGTTGAAAGG + Intergenic
1033608500 7:142944375-142944397 GCTCAACTGCAGGTGGAGATGGG - Exonic
1036964952 8:13286977-13286999 GCACAAATGCGGATGGTGAAAGG + Intronic
1037616586 8:20524587-20524609 TCTCCAGGGCAGGTGGTGAGGGG + Intergenic
1043034915 8:75184479-75184501 CCTCAAATAAAGGAGGTGAAAGG + Intergenic
1044515992 8:93139492-93139514 ACTCCTATGGAGGTGGTGAAGGG - Intronic
1045925388 8:107575337-107575359 TCTAAAATCCAGGTGGGGAGAGG + Intergenic
1047079861 8:121447483-121447505 TCTCTAAGGCATGTGGTGTAGGG + Intergenic
1050586483 9:7117351-7117373 TCTCAATTACAGTTGGTGAATGG - Intergenic
1050941701 9:11468850-11468872 TCTTAAATGCAGGTTGTTCATGG + Intergenic
1051117541 9:13713772-13713794 ACTCAAATGAAGGTGCAGAATGG - Intergenic
1051324747 9:15953212-15953234 TGTTGAATGCAAGTGGTGAAAGG + Intronic
1051997114 9:23231053-23231075 TCACAAATGCAAGTGGTTCATGG + Intergenic
1052776308 9:32736729-32736751 TATCAAAGGCAGGTGCTGAGTGG - Intergenic
1056000177 9:82207137-82207159 TCAAAAATGGAGGTGGTGGAAGG - Intergenic
1057051483 9:91927486-91927508 TAGCAAATGGAGGTGGTGAATGG - Intronic
1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG + Intronic
1059965968 9:119614162-119614184 TCTCTAATGGAGGTGGTTGAGGG - Intergenic
1188721922 X:33532627-33532649 TCTCAAATTCAGATTTTGAAAGG + Intergenic
1190968836 X:55329503-55329525 TAGCAAATGCAGGTGGGGAGGGG - Intergenic
1194439494 X:93913900-93913922 TCTCAAATGGAGGTGCAGAGAGG + Intergenic
1195112696 X:101663785-101663807 GCCCAAATGGAAGTGGTGAAGGG + Intergenic
1195255209 X:103083103-103083125 TCTGAAGTTGAGGTGGTGAAGGG + Intronic
1198695491 X:139332538-139332560 CCTCACATGGAGGTGGTGACAGG - Intergenic