ID: 919030464

View in Genome Browser
Species Human (GRCh38)
Location 1:192235662-192235684
Sequence GAGAGTCTCAAATGTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919030459_919030464 19 Left 919030459 1:192235620-192235642 CCCATGGTTATAGCAGGATCATT No data
Right 919030464 1:192235662-192235684 GAGAGTCTCAAATGTGAGTAGGG No data
919030460_919030464 18 Left 919030460 1:192235621-192235643 CCATGGTTATAGCAGGATCATTC No data
Right 919030464 1:192235662-192235684 GAGAGTCTCAAATGTGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919030464 Original CRISPR GAGAGTCTCAAATGTGAGTA GGG Intergenic
No off target data available for this crispr