ID: 919030836

View in Genome Browser
Species Human (GRCh38)
Location 1:192240062-192240084
Sequence AGTACTATGTAGAAAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919030836_919030839 7 Left 919030836 1:192240062-192240084 CCCTGCTCTTTCTACATAGTACT No data
Right 919030839 1:192240092-192240114 AATATATTTAATATACTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919030836 Original CRISPR AGTACTATGTAGAAAGAGCA GGG (reversed) Intergenic
No off target data available for this crispr