ID: 919037824

View in Genome Browser
Species Human (GRCh38)
Location 1:192338687-192338709
Sequence GAAAAGTTAAGGCTACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919037824 Original CRISPR GAAAAGTTAAGGCTACAGTG TGG (reversed) Intronic
904194235 1:28773031-28773053 GGAAGGTTGAGGCTGCAGTGAGG - Intergenic
905193238 1:36252539-36252561 GCAAAGTTGAGGCTACTCTGTGG + Intronic
906376615 1:45301612-45301634 GAGAGGTTGAGGTTACAGTGAGG + Intronic
907199733 1:52716190-52716212 GGAAAGTGGAGGCTGCAGTGAGG + Intergenic
907661381 1:56395624-56395646 GAAATTTTAAGGTTACAGTGAGG + Intergenic
908221796 1:62014637-62014659 GTAAGGTTGAGGCTGCAGTGAGG - Intronic
909320133 1:74275101-74275123 GAAGAGTTAAGAGTTCAGTGAGG + Intronic
910182374 1:84499516-84499538 CAAAATTTGAGGTTACAGTGAGG - Intronic
910487476 1:87731440-87731462 GAGAGGTTGAGGCTGCAGTGAGG - Intergenic
910862271 1:91753315-91753337 AGAAGGTTGAGGCTACAGTGAGG + Intronic
911624667 1:100108337-100108359 AAAATGTTAAGTCTACATTGTGG - Intronic
911926819 1:103843193-103843215 GAAAAGTTAAGGGCCAAGTGAGG - Intergenic
912094719 1:106124304-106124326 AGAAAGTTGAGGCTGCAGTGAGG - Intergenic
916640818 1:166726936-166726958 GAAATGGTAACTCTACAGTGGGG + Intergenic
916921716 1:169476057-169476079 GGAAAACTAAGACTACAGTGTGG + Intronic
917831483 1:178894314-178894336 CAAAAGTTACGGTTACTGTGTGG - Intronic
918556618 1:185808444-185808466 GGAAAGTTGAGGCTGCAGTGAGG + Intronic
919037824 1:192338687-192338709 GAAAAGTTAAGGCTACAGTGTGG - Intronic
919836945 1:201581476-201581498 GAGAAGTTAAGGCCAGAGAGAGG + Intergenic
921922143 1:220682306-220682328 GAAAGGTGGAGGCTGCAGTGAGG - Intergenic
923356744 1:233163702-233163724 AGAAAGTCAAGGCTATAGTGAGG - Intronic
1064949362 10:20830542-20830564 TAAAAATTAAGGGAACAGTGAGG - Intronic
1065359810 10:24878901-24878923 GCAAAGTTAAGGCCTCTGTGGGG - Intronic
1066669853 10:37825509-37825531 GGGAAGTTTAGGCTGCAGTGAGG - Intronic
1068802891 10:61162226-61162248 GAAAAGTCATGGCTTCAGAGAGG + Intergenic
1068860046 10:61838794-61838816 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1070256961 10:74821217-74821239 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1070925853 10:80221039-80221061 GAAAAATGAAGGCTAGAGAGTGG - Intergenic
1071704633 10:87983740-87983762 GAAAAAGTAAGACTACTGTGGGG - Intergenic
1071910385 10:90225259-90225281 GCTAAGTTCAGGCTGCAGTGAGG - Intergenic
1073994742 10:109302186-109302208 GAAAAGATAAGCCTAAAGTTTGG - Intergenic
1074142856 10:110690477-110690499 AAAAAGTTAAGGAAATAGTGTGG - Intronic
1074786903 10:116849540-116849562 GGAGATTTAAGGCTACAGCGGGG - Exonic
1076246786 10:128953264-128953286 TGGAAGTTAAGGCTACAGTGAGG - Intergenic
1076547295 10:131253959-131253981 GAAAAGCAAACGCAACAGTGAGG + Intronic
1080662464 11:34308416-34308438 AAAAACTTAAGACTGCAGTGTGG + Intronic
1081692686 11:45088884-45088906 GGGAGGTTGAGGCTACAGTGAGG - Intergenic
1081732259 11:45379902-45379924 GAACAGTTAAGGCAAAAGAGAGG - Intergenic
1082275160 11:50213366-50213388 GAAAAGATAAGGCTATTTTGTGG - Intergenic
1084289229 11:68151217-68151239 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
1086036500 11:82421761-82421783 GACAATTTAAGGCTTCTGTGAGG - Intergenic
1086804201 11:91219502-91219524 GAAAACTTAAGACTACAATTTGG - Intergenic
1087799923 11:102492589-102492611 GGGAAGTTGAGGCAACAGTGAGG + Intronic
1089574047 11:119428992-119429014 GAGAGGTTGAGGCTTCAGTGAGG + Intergenic
1090752493 11:129759758-129759780 GAAAAGTCTAGGCTCCTGTGGGG - Intergenic
1091203361 11:133800047-133800069 GAAAAGGCAAGGCTTCAGTGCGG + Intergenic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1092356239 12:7797724-7797746 GGGAAGTCGAGGCTACAGTGAGG - Exonic
1093338433 12:17938970-17938992 GAAGAGATAAGGCTGCAGAGAGG - Intergenic
1094696921 12:32829006-32829028 GGAAAGTTGAGGCTGCAGTGAGG - Intronic
1095441851 12:42245902-42245924 GGGAAGTTAGGGCTGCAGTGAGG - Intronic
1096354932 12:50932828-50932850 GAAAAGTTATTGATGCAGTGAGG + Intergenic
1097797434 12:63879075-63879097 GAAAGATTGAGGCTGCAGTGAGG - Intronic
1100021826 12:90078007-90078029 TAAAAGTAAAGTATACAGTGTGG - Intergenic
1100447364 12:94673850-94673872 GAAAATCTAAGTCTACCGTGGGG + Intergenic
1100471927 12:94901361-94901383 AAAAGGTCAAGGCTGCAGTGAGG + Intronic
1102118337 12:110420704-110420726 GGGAAGTTGAGGCTACAGTGAGG - Intergenic
1105788765 13:23776104-23776126 AAAAAGTTAAGGTTTCAGTATGG - Intronic
1107203183 13:37747472-37747494 GAAAAGTTAATGCTACATAAGGG + Intronic
1108177345 13:47806642-47806664 GAAAAGGTAAAACTACAGAGAGG + Intergenic
1109682393 13:65769764-65769786 GCAAAGTTAAGTTTACAGTTAGG + Intergenic
1110473418 13:75886308-75886330 GAAACGTTGAGGCTACTGGGTGG - Intergenic
1110510911 13:76349171-76349193 TAAAACATAAGTCTACAGTGTGG - Intergenic
1111281676 13:86033354-86033376 GAACAGTGAAGTATACAGTGGGG - Intergenic
1111410918 13:87875388-87875410 GAGAAATTAAGGCCACAATGAGG - Intergenic
1112151198 13:96766266-96766288 GAAAAGTAAATGTGACAGTGTGG + Intronic
1112517897 13:100071430-100071452 AAAAAGCTGAGGCCACAGTGGGG + Intergenic
1112557376 13:100481016-100481038 CAAAAGTTACAGCCACAGTGTGG - Intronic
1114332293 14:21649597-21649619 GAATAATTAAGGGTAGAGTGAGG + Intergenic
1116034886 14:39615768-39615790 TAAATGTTAAGGCTATAGAGAGG - Intergenic
1117016439 14:51523076-51523098 GAAAATTTAAAACTACAGAGAGG - Intronic
1117742340 14:58831794-58831816 GGAAAGGTAAAGCTACAGTGGGG - Intergenic
1119597456 14:75948562-75948584 GAAAATTTATGCTTACAGTGAGG + Intronic
1120589016 14:86352837-86352859 GAAAAGTTAAGTCTCCATTCAGG + Intergenic
1122735241 14:103835501-103835523 CAGAAGTTGAGGCTGCAGTGAGG - Intronic
1124453136 15:29816520-29816542 CAAAAATTATTGCTACAGTGAGG + Intronic
1124826321 15:33099216-33099238 GGAAGGTTGAGGCTGCAGTGAGG + Intronic
1125653430 15:41336717-41336739 GAGAGGTTGAGGCTGCAGTGAGG - Intronic
1125798698 15:42425140-42425162 GATAAGTTAAGGCTGCAGAGTGG - Intronic
1125814120 15:42569377-42569399 GAGAGGTCAAGGCTGCAGTGAGG - Exonic
1127614214 15:60667496-60667518 GAGAAGTTAAGGTTATGGTGTGG + Intronic
1128658048 15:69476960-69476982 GAAAAAACGAGGCTACAGTGAGG - Intergenic
1129129178 15:73476586-73476608 GAAAAGGCAAAACTACAGTGAGG - Intronic
1129320455 15:74771888-74771910 GGAAAGTAAGGGCTCCAGTGCGG + Intergenic
1129342519 15:74895518-74895540 GGACAGTTGAGGCTGCAGTGAGG + Intronic
1130404008 15:83581805-83581827 GACAACCAAAGGCTACAGTGTGG - Intronic
1132063680 15:98713128-98713150 GAAAAGGCAAGGCTAGAGTTCGG - Intronic
1134273942 16:12759088-12759110 AAGAAGTAGAGGCTACAGTGAGG + Intronic
1134876071 16:17700016-17700038 GAAAAGATAAGGCTGAAATGAGG - Intergenic
1137329164 16:47472865-47472887 GAAAGGTTGAGGCTACAGTGAGG + Intronic
1138002036 16:53290703-53290725 GAAAGGTTGAGGCTGCAGTGAGG + Intronic
1140069364 16:71635657-71635679 GAAAAATTCAGGCTGAAGTGTGG - Intronic
1141544713 16:84757710-84757732 TAAAAGTAAAGGAGACAGTGTGG + Intronic
1144174843 17:12695201-12695223 GGAAAGTTAAAGCTACAGGCAGG + Intronic
1144358791 17:14471069-14471091 GAGGAGTTATGGCTACTGTGAGG + Intergenic
1146571239 17:33955202-33955224 GAACAGTGATGGCTAGAGTGTGG - Intronic
1146821974 17:35990726-35990748 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
1146999708 17:37352644-37352666 GACAGGTTGAGGCTGCAGTGAGG + Intronic
1147609901 17:41795566-41795588 GAACACTTCAGCCTACAGTGGGG + Intergenic
1147632234 17:41939595-41939617 GAAAAGTACAGGATCCAGTGTGG + Intronic
1148287699 17:46410347-46410369 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1148309868 17:46627927-46627949 GGGAAGTTGAGGCTGCAGTGAGG + Intronic
1149197931 17:54145242-54145264 GAAAATTTAATTCAACAGTGTGG - Intergenic
1149817223 17:59737228-59737250 GTAAGGAAAAGGCTACAGTGGGG + Intronic
1150053330 17:61987822-61987844 GAGAGGTCAAGGCTACAGTGAGG - Intronic
1153886502 18:9472834-9472856 GAAAAGTACAGGCTGGAGTGAGG + Intergenic
1156281190 18:35640706-35640728 TAAAAGTTAAGACAACAGTATGG + Intronic
1157439876 18:47702548-47702570 GAAAATTTCAGGCCCCAGTGAGG - Intergenic
1159480346 18:68982359-68982381 GGATAGTTAAGGGTAGAGTGGGG - Intronic
1160668928 19:347139-347161 GAAATGTTAATGCCACAATGGGG + Intergenic
1161918457 19:7248411-7248433 GAGAGGTTGAGGCTTCAGTGAGG + Intronic
1161969051 19:7566067-7566089 GAAATTTTGAGGTTACAGTGAGG + Intergenic
1162244826 19:9391111-9391133 CAGAAGTCAAGGCTGCAGTGAGG + Intergenic
1162324514 19:9991167-9991189 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
1162831515 19:13287366-13287388 GAAAAGGAAAGGGTACAGTTTGG + Intronic
1167379156 19:49128646-49128668 GAAAAGTTATGGAGACAGGGAGG - Intronic
1167852575 19:52213326-52213348 GCAAAGTTAAGGCTACGTGGAGG + Intronic
925319752 2:2953452-2953474 GAAAAGTCAAGACTCCAGAGGGG + Intergenic
927361606 2:22241574-22241596 GAGAGGTTAAGGATCCAGTGTGG - Intergenic
929188040 2:39115485-39115507 GAGAGGTCAAGGCTGCAGTGAGG - Intronic
929273046 2:39995171-39995193 GAAGAGTTGAGGCTCCTGTGGGG + Intergenic
929930796 2:46254057-46254079 GAAATGTTTTGTCTACAGTGGGG - Intergenic
931639221 2:64367130-64367152 CAAAAGTTAAGACTACAGGTGGG + Intergenic
932267272 2:70378482-70378504 TAAAAATTAAGGCTCCAGTCTGG - Intergenic
932501447 2:72186315-72186337 GAAATGCTGATGCTACAGTGTGG - Intronic
935258699 2:101335861-101335883 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
935479239 2:103563649-103563671 GGAAGGTCAAGGCTACAGGGAGG + Intergenic
936110479 2:109660561-109660583 GAAAAGCTGAGCCTACAGGGAGG + Intergenic
937477492 2:122228299-122228321 GAACAGCAAAGGCTAAAGTGAGG + Intergenic
938411555 2:131068941-131068963 GAAAAGTCGAGGCTGCAGTGAGG + Intronic
938552575 2:132394899-132394921 GAGCAGTAAAGGGTACAGTGAGG - Intergenic
938879261 2:135568126-135568148 GGGAAGTTGAGGCTGCAGTGAGG - Intronic
939451390 2:142379400-142379422 TAAAAGTTCAGTTTACAGTGTGG - Intergenic
941802279 2:169673004-169673026 GAACAGTTGAGAGTACAGTGAGG + Intronic
941931982 2:170950907-170950929 GAGAGGTTGAGGCTGCAGTGAGG + Intronic
942085334 2:172438203-172438225 GAAAAGTTAATGCAAGAGAGGGG + Intronic
943061150 2:183042805-183042827 GAAAAGACAGGGCAACAGTGAGG + Intergenic
945511422 2:210707427-210707449 AAATATTTAAGGCTACAGTGTGG - Intergenic
948187178 2:236030568-236030590 CAAAAGTGAAGGCTACCCTGAGG - Intronic
948644574 2:239396047-239396069 GGAAAGTCAAGGTTGCAGTGAGG - Intronic
1168779547 20:477265-477287 AAGAAGTCAAGGCTGCAGTGAGG - Intronic
1169246074 20:4025935-4025957 GAAAAGGTAAGACTATAGGGAGG - Intergenic
1174802950 20:53580507-53580529 GAGAAGCTCTGGCTACAGTGAGG + Intronic
1175199885 20:57269624-57269646 GAAAAGATAAGGCTAAATGGGGG - Intergenic
1175443342 20:59005511-59005533 GAAAAGGATAGACTACAGTGTGG - Intronic
1177041687 21:16120607-16120629 GAAAAGTCAAGCCTGCTGTGAGG - Intergenic
1177197873 21:17921747-17921769 CACAGGTTAAGGCTACAGTCAGG + Intronic
1180130211 21:45822251-45822273 GAAAGGCTCAGGCTGCAGTGGGG - Intronic
1182581873 22:31318516-31318538 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1184927515 22:47653631-47653653 GAAAAGTTGAGTCCAAAGTGAGG + Intergenic
950457084 3:13099233-13099255 GGGAAGTTGAGGCCACAGTGAGG + Intergenic
956021757 3:64940653-64940675 AAACAGTTAAGGCTAGAGAGAGG + Intergenic
956113853 3:65898992-65899014 GGGAAGTTGAGGCTTCAGTGAGG - Intronic
961868726 3:129973397-129973419 GGGAGGTCAAGGCTACAGTGAGG + Intergenic
962113918 3:132481506-132481528 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
962115398 3:132500805-132500827 CATAAGTAAATGCTACAGTGTGG + Exonic
963220704 3:142808657-142808679 CAAAAGTTACAGCCACAGTGTGG + Intergenic
963279082 3:143363921-143363943 AAAAGGTCAAGGCTAAAGTGAGG + Intronic
965182617 3:165424129-165424151 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
967009556 3:185419357-185419379 GAAATGTTAAGGATACTGTCAGG - Intronic
967325678 3:188236454-188236476 GAAAAGTGAAGAGGACAGTGTGG + Intronic
970194196 4:13540007-13540029 GAAGAGTTAATGCCACATTGCGG - Intergenic
970586910 4:17523137-17523159 GGAAGGTCAAGGCTCCAGTGGGG - Intronic
972363367 4:38349772-38349794 AAGAGGTTGAGGCTACAGTGAGG + Intergenic
974178381 4:58354607-58354629 GAAAAGTCAAGGCTGAAGTTGGG + Intergenic
974423712 4:61712318-61712340 GGAAGGTTGAGGCTACTGTGAGG + Intronic
975879451 4:78885925-78885947 TAAAAATTGAGGCTACAGTGAGG - Intronic
976017486 4:80575396-80575418 GGGAAGTCAAGGCTGCAGTGAGG - Intronic
978774172 4:112489420-112489442 GAAAAGTAAAAGCTATAGTATGG + Intergenic
978969324 4:114783777-114783799 GAAAAGATAAGGCCACATTCAGG - Intergenic
979100695 4:116609181-116609203 GAAAATTTCAGGATATAGTGAGG + Intergenic
980766681 4:137315237-137315259 GAAATGTAAAGACTACAGAGTGG - Intergenic
980885922 4:138762156-138762178 GACAAATTTAGACTACAGTGTGG + Intergenic
980928632 4:139163839-139163861 GCCAAGTTAAGCCTACAGTGAGG + Intronic
981947339 4:150363056-150363078 GAGCAGTTGAGGCTGCAGTGAGG + Intronic
984662034 4:182384695-182384717 GACAAGGGAAGGCTGCAGTGTGG - Intronic
984789840 4:183605390-183605412 CAAAAGTACAGTCTACAGTGTGG - Intergenic
985420270 4:189778458-189778480 AAAAAGTTAAGCCTATATTGAGG - Intergenic
986615672 5:9614892-9614914 AAAAAGCTATGGCTACAGTAAGG + Intergenic
987113805 5:14711407-14711429 GAAGGTTTAAGCCTACAGTGAGG - Intronic
987199183 5:15557391-15557413 GATGAGTTAAGGATACAGTTTGG - Intronic
987255746 5:16149178-16149200 TTGAAGTTAGGGCTACAGTGGGG - Intronic
987688252 5:21232876-21232898 GAGAGGTTGAGGCTACTGTGAGG + Intergenic
988497582 5:31758162-31758184 GAAAAGTTTAGAATCCAGTGCGG - Intronic
989279393 5:39623102-39623124 GAAAAGTTAAGAAAACAGTAAGG - Intergenic
992208627 5:74455359-74455381 GAAAGGTCAAGGCTGTAGTGAGG + Intergenic
992276457 5:75125789-75125811 GAAAAGCTAAAGCTAAAGTTGGG + Intronic
997900200 5:137756250-137756272 GAATACTTGAGGATACAGTGAGG - Intergenic
1001110866 5:168895146-168895168 GAACATTTAAGGTTACAGTGGGG - Intronic
1001503082 5:172254427-172254449 GAAAAGCTACGGTTACAGTCCGG + Intronic
1003134479 6:3423812-3423834 TAAATGTTAATGCTACAGTCCGG - Intronic
1004446183 6:15700938-15700960 AGAAAGTCAAGGCTGCAGTGAGG + Intergenic
1004916635 6:20338903-20338925 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1005431437 6:25761976-25761998 CAGATGTCAAGGCTACAGTGGGG + Exonic
1006965008 6:37974475-37974497 AGAAAGTTGAGGCTGCAGTGAGG - Intronic
1007004613 6:38348979-38349001 CAGAAGTTGAGGCTGCAGTGAGG - Intronic
1007013864 6:38443186-38443208 GAAAAATTCAGGCTGCTGTGAGG + Intronic
1007293658 6:40805278-40805300 CAAAAGTTATGGGTACAGGGAGG - Intergenic
1008306141 6:49902526-49902548 GAAAAGGTAAGGAGACAGTAAGG - Intergenic
1010585333 6:77651197-77651219 GAAAAATAAAGGCAAGAGTGAGG + Intergenic
1012377590 6:98581037-98581059 GAAATTTTAAGTCCACAGTGAGG + Intergenic
1013757614 6:113480105-113480127 TAAAAGCTAAGGGTACAGTCAGG + Intergenic
1015581057 6:134725793-134725815 AAAGAGTCTAGGCTACAGTGAGG - Intergenic
1016897481 6:149067423-149067445 GAATAGTTAAGGATCCAGGGAGG - Intronic
1022528862 7:31054573-31054595 GGAAAGCTAAGGCCACAGGGTGG + Intronic
1023627436 7:42129977-42129999 GGAAAGTGAAGGCTTCAGCGTGG + Intronic
1024614076 7:51093308-51093330 GCAAAGTAAAATCTACAGTGAGG + Intronic
1026350186 7:69508819-69508841 AGGAAGTCAAGGCTACAGTGAGG - Intergenic
1027600523 7:80234260-80234282 GAAAAGTTAAAGATACAGGAGGG - Intergenic
1027965463 7:85000056-85000078 GAAAAATTAAGGATATAGTTTGG - Intronic
1029724259 7:102391759-102391781 GAAAAGCTAGGGCTACAGGCAGG - Intronic
1030892276 7:115013555-115013577 AGAAAGTTAAGGTTTCAGTGAGG + Intronic
1034651507 7:152694525-152694547 CAAAAATGAAGGGTACAGTGTGG + Intergenic
1035299942 7:157890709-157890731 GAAATGTCAGAGCTACAGTGGGG - Intronic
1038112709 8:24517381-24517403 CAAAAGGTAAAGCTAAAGTGGGG - Intronic
1038530317 8:28313380-28313402 GGGAAGTTGAGGCTGCAGTGAGG - Intergenic
1042871677 8:73405496-73405518 GTAAAGTTTGGGCTTCAGTGGGG - Intergenic
1042892630 8:73629837-73629859 TGAAAGTTGAGGCTGCAGTGAGG - Intronic
1045736445 8:105301228-105301250 GAGAGATTGAGGCTACAGTGAGG - Intronic
1045922966 8:107554178-107554200 GCAAAGTGAAGGCCAGAGTGAGG - Intergenic
1046212344 8:111093537-111093559 CAAAAGTTAAGGCTGTAGTGAGG + Intergenic
1046451807 8:114402584-114402606 GTAAAGTAAAGCCTACAGAGTGG + Intergenic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1052992055 9:34524075-34524097 GAGAAGTTAAGGCTAGACTTGGG - Intergenic
1053081429 9:35181023-35181045 GGGAAGTGAAGGCTACACTGAGG + Intronic
1054799815 9:69335909-69335931 AGAAAGTCAAGGCTGCAGTGAGG + Intronic
1055442564 9:76351102-76351124 GTAAAGCTAAGGCTACAGGTGGG - Intronic
1060210549 9:121707512-121707534 GAAAAGTTAGGGCGACAGGCAGG - Intronic
1060341518 9:122781221-122781243 TGTAAATTAAGGCTACAGTGAGG + Intergenic
1060782750 9:126424987-126425009 GAAAAGTTAAGGCTACTGTATGG - Intronic
1060938740 9:127531105-127531127 GGAAGGTTGAGGCTGCAGTGAGG + Intronic
1061066607 9:128282004-128282026 AGAAAGTTGAGGCTACAGTGAGG + Intronic
1061116103 9:128613342-128613364 AAAAAGCAAAGGCTACTGTGTGG - Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1186050283 X:5584911-5584933 GGGAAGTTGAGGCTGCAGTGAGG + Intergenic
1187519026 X:19997500-19997522 GAAAAGTTAAGACGAGACTGTGG - Intergenic
1189383747 X:40520185-40520207 GGAAAGTCGAGGCTGCAGTGAGG + Intergenic
1189394484 X:40608779-40608801 AAAAAGTTAAGTTTAGAGTGGGG - Intergenic
1189450418 X:41123740-41123762 TACTAGTTAAAGCTACAGTGGGG + Intronic
1190486567 X:50931682-50931704 AAAAAGTTCAGGTTACAGAGTGG - Intergenic
1192538922 X:71951853-71951875 GGAAAGCCAAGTCTACAGTGAGG - Intergenic
1194022300 X:88706653-88706675 GAGAAGTAAAACCTACAGTGAGG - Intergenic
1195563052 X:106306973-106306995 CAGAAGTTGAGGCTGCAGTGAGG - Intergenic
1195887453 X:109654921-109654943 GAAAAGAGAAGGATTCAGTGAGG + Intronic
1195916882 X:109944534-109944556 GGGAGGTTAAGGCTGCAGTGAGG + Intergenic
1196025653 X:111039050-111039072 GAAAAGTTATGGCTTAAGTTGGG - Intronic
1197333942 X:125188258-125188280 GGAAGGTTGAGGCTGCAGTGAGG + Intergenic
1198340869 X:135712450-135712472 GAAAAATGAGGGCCACAGTGTGG - Intergenic
1198641963 X:138766094-138766116 CAAAGGTACAGGCTACAGTGGGG - Intronic
1199762308 X:150914236-150914258 GGGAGGTTGAGGCTACAGTGAGG + Intergenic