ID: 919037875

View in Genome Browser
Species Human (GRCh38)
Location 1:192339517-192339539
Sequence TGGCAATCCATTAAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919037875_919037876 -10 Left 919037875 1:192339517-192339539 CCTGTTTTTTTAATGGATTGCCA 0: 1
1: 0
2: 2
3: 19
4: 319
Right 919037876 1:192339530-192339552 TGGATTGCCATGATCATGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919037875 Original CRISPR TGGCAATCCATTAAAAAAAC AGG (reversed) Intronic
905763226 1:40578445-40578467 TGGTGATCCATTAAAAAGTCAGG + Intergenic
905998548 1:42403332-42403354 TGACAAACCACTAAAAAACCAGG + Intronic
906233867 1:44190982-44191004 TGACAACCCATTAGAAAAATGGG - Intergenic
907096746 1:51788871-51788893 TAAAAATACATTAAAAAAACAGG + Intergenic
907704497 1:56820653-56820675 TGGGAATCTATCAAAAATACAGG + Intergenic
908240303 1:62183608-62183630 TGGTAATCCAACAAAGAAACAGG + Intergenic
908651259 1:66335999-66336021 TGGCTCTCCATTATAAAAAGAGG + Intronic
908831238 1:68180629-68180651 TGGTAATCCAACAAAGAAACAGG - Intronic
909144669 1:71915099-71915121 TGACAAAACATTAAAAAAAAAGG - Intronic
909363631 1:74794287-74794309 TGGCACAGCTTTAAAAAAACAGG + Intergenic
910620827 1:89252412-89252434 TGCCAATACATTGAAAAATCTGG + Intergenic
912221509 1:107682494-107682516 TTTGAAGCCATTAAAAAAACAGG - Intronic
912380381 1:109244645-109244667 TGGCACTTCAATAAGAAAACTGG + Intergenic
916206576 1:162320939-162320961 TGGCAAACCTTAAAAAAAAGTGG - Intronic
917398928 1:174624651-174624673 TGGCAATTCATTGAAGACACTGG + Intronic
917555552 1:176084093-176084115 TGGCAGACCTTTAAAAAAAGAGG - Intronic
917578179 1:176345949-176345971 TGGTAATTTATTAAAAAAAGAGG + Intergenic
918790557 1:188822053-188822075 TGGCAATTCCTTAAAAACACTGG + Intergenic
919037875 1:192339517-192339539 TGGCAATCCATTAAAAAAACAGG - Intronic
919204481 1:194404077-194404099 TGTCAATTTATTAAGAAAACTGG + Intergenic
919559945 1:199104920-199104942 TGTCAATCCATTATAGAAAATGG + Intergenic
921678912 1:218008450-218008472 TGGTAATCCAACAAAGAAACAGG + Intergenic
921880659 1:220250926-220250948 TGGTAATTTATTAAAAAAAGAGG - Intronic
922522897 1:226272818-226272840 TGGTAATCCAACAAAGAAACAGG - Intronic
922640961 1:227231651-227231673 TGGCAATCATTAAAAAAATCAGG - Intronic
923280297 1:232437097-232437119 TGAAAATCCATTACAAATACCGG + Intronic
923371721 1:233321233-233321255 TGGTGTTCCATTAAAAAAGCAGG + Intergenic
923388882 1:233493701-233493723 TTGTGATCCATTAAAAAAAATGG - Intergenic
924275782 1:242385472-242385494 TGGTAATCCAACAAAGAAACAGG - Intronic
924928248 1:248704531-248704553 TGGTAATCCAGCAAAGAAACAGG + Intergenic
1062940103 10:1414626-1414648 TGGTAATCCAACAAAGAAACAGG - Intronic
1063287559 10:4707074-4707096 TGTCAATCCATACATAAAACAGG + Intergenic
1063553818 10:7058698-7058720 TGGCAATCATTTAAAAAGTCAGG - Intergenic
1068164405 10:53309660-53309682 TGGCATTCCAGTCATAAAACTGG - Intergenic
1070581408 10:77723016-77723038 TGGTAATCCAACAAAGAAACAGG + Intergenic
1071058589 10:81541980-81542002 TGACAATCCAGTAGAAAAATGGG + Intergenic
1074280391 10:112045973-112045995 TGGCATTCCTTTAAAATAATGGG + Intergenic
1074525067 10:114255970-114255992 TGGCAAATCTTGAAAAAAACTGG + Intronic
1078312675 11:10260987-10261009 TGGCAATCCAATTATAAAATAGG + Intronic
1078325842 11:10380227-10380249 TGGCTTTCCATTAAAAAAGAGGG - Intronic
1079796565 11:24811148-24811170 TGGCAGTCAATAAGAAAAACTGG - Intronic
1081006384 11:37748683-37748705 TGGTAATCCAACAAAGAAACAGG + Intergenic
1081277237 11:41165089-41165111 TGGTGATCCAATAAAGAAACAGG - Intronic
1083502716 11:63125825-63125847 TGGCAATCATTTAAAAAGTCAGG - Intronic
1085430893 11:76446524-76446546 TGGCATTTCATTTAATAAACAGG - Intronic
1086116073 11:83252072-83252094 AGACAGTCCAGTAAAAAAACTGG + Intronic
1086748115 11:90455744-90455766 TGGTAATCCAACAAAGAAACAGG - Intergenic
1087794765 11:102444019-102444041 TGGCAATCATTTAAAAAGTCAGG + Intronic
1088019800 11:105105492-105105514 TGGTAATCCAATTAAAAATCTGG + Intergenic
1088217004 11:107522199-107522221 TGGCAATGATCTAAAAAAACAGG + Intronic
1088931667 11:114357588-114357610 TGGTAATCCAAGAAAGAAACAGG - Intergenic
1088944813 11:114500443-114500465 AGACAACCCATTAAAAAAATGGG + Intergenic
1093302337 12:17472432-17472454 TGGTAATCCAACAAAGAAACAGG - Intergenic
1093348219 12:18066889-18066911 TGGTAATCCAACAAAGAAACAGG - Intergenic
1093348831 12:18071681-18071703 TGGTAATCCAACAAAGAAACAGG - Intergenic
1093381948 12:18503793-18503815 TTGCAAACCATTAAGAAAATGGG - Intronic
1093488076 12:19674386-19674408 AGACAATCCAATAGAAAAACTGG - Intronic
1094064524 12:26349200-26349222 TGACAATTCATTCTAAAAACAGG + Intronic
1094705636 12:32911977-32911999 AGGCAATCCATGAAGAAAAGAGG + Intergenic
1098489750 12:71061595-71061617 ATGAAATGCATTAAAAAAACAGG + Intronic
1099384384 12:81997293-81997315 TGGCAATTAAAAAAAAAAACAGG + Intergenic
1101070245 12:101067118-101067140 TCACAATCCATTATAAAAAGTGG - Intronic
1101198275 12:102408052-102408074 TGGCACTCTATAAAAAATACTGG + Intronic
1103076267 12:117985385-117985407 TGCCAATCTATTAAAAAATTTGG + Intergenic
1104262548 12:127197714-127197736 TGGCAATCCATTATCCACACAGG + Intergenic
1106500686 13:30325579-30325601 TGGCTATCCATCCAGAAAACTGG - Intergenic
1107312501 13:39094139-39094161 TGGTAATCCAACAAAGAAACAGG - Intergenic
1107952751 13:45479001-45479023 TTGCAAACCATGAGAAAAACTGG - Exonic
1109403298 13:61863137-61863159 TGGCAATCAAACAAAGAAACAGG + Intergenic
1109728408 13:66376817-66376839 TGGCAATACATTAAAAAAGATGG + Intronic
1109909771 13:68893728-68893750 TGGTAATCCAACAAAGAAACAGG + Intergenic
1110284422 13:73732924-73732946 TGGCAGTCCAGAACAAAAACAGG + Intronic
1110887544 13:80657759-80657781 TGGTAATCCAACAAAGAAACAGG + Intergenic
1111208666 13:85047658-85047680 TGACAATCCATTAAAAAAATGGG + Intergenic
1111375705 13:87377042-87377064 TGGCAATCATTTAAAAAGTCAGG + Intergenic
1112095109 13:96124213-96124235 TGGCAATTCAGTAGAACAACAGG - Intronic
1112998478 13:105602997-105603019 TAGAAATCCATTAAAAGAAATGG + Intergenic
1113618943 13:111700295-111700317 TGGCAAGCCATTTAAAGAAAAGG - Intergenic
1113624472 13:111785556-111785578 TGGCAAGCCATTTAAAGAAAAGG - Intergenic
1114314595 14:21497833-21497855 TCCAAAACCATTAAAAAAACAGG - Exonic
1114932969 14:27497600-27497622 TGTAAATCCAGTAAAAAAAAAGG + Intergenic
1115523420 14:34255576-34255598 TGGCAGGCCATTATAAAAACAGG + Intronic
1116054317 14:39844162-39844184 TGGTAATCCAACAAAGAAACAGG - Intergenic
1116421514 14:44738039-44738061 TGGGACTCCATTAAAGTAACAGG - Intergenic
1119293239 14:73512843-73512865 AGGCAATCCATTAGGTAAACTGG - Intronic
1119629808 14:76219264-76219286 TAGCAATCCAGTATAAAAATGGG + Intronic
1120080617 14:80211955-80211977 TGGCAATTCAAGAAAGAAACAGG - Intronic
1120354819 14:83418453-83418475 TGGAAATACAATAACAAAACAGG + Intergenic
1121151671 14:91640903-91640925 TGGCAATCATTAAAAACAACAGG - Intronic
1124174615 15:27411684-27411706 TGGCAACCACTTAAAAACACAGG - Intronic
1124719069 15:32096314-32096336 AGGCAATCCAATAGAAAAATGGG - Intronic
1125221944 15:37348242-37348264 GAGCAATCCAATAAAAGAACAGG + Intergenic
1127648094 15:60977450-60977472 TGGTATCTCATTAAAAAAACAGG - Intronic
1130029277 15:80296824-80296846 TGGCATTTGATTAAAATAACTGG - Intergenic
1132177217 15:99725376-99725398 TGGTAATCCAACAAAGAAACAGG - Intronic
1133974821 16:10593148-10593170 TGCCTATCCATTTAATAAACTGG + Intergenic
1135224217 16:20641586-20641608 TGGTAATCCAACAAAGAAACAGG - Intronic
1137577531 16:49611680-49611702 TGAAAATCAATTAAACAAACAGG + Intronic
1138686322 16:58729078-58729100 AGGCAAGCTATTAAAAGAACTGG - Intronic
1140340541 16:74155331-74155353 ATGCAACCCATTAAAAATACTGG - Intergenic
1140419178 16:74803667-74803689 TTGCAATTCATCAAAAAAATAGG - Intergenic
1140503003 16:75451246-75451268 AATCAATACATTAAAAAAACTGG + Intronic
1140866900 16:79070435-79070457 TAGCAATCCATCAAGAAAAAGGG - Intronic
1140973237 16:80033929-80033951 TGGCAATTCAATATAAAAAATGG + Intergenic
1145364086 17:22239802-22239824 TGGTAATCCAACAAAGAAACAGG - Intergenic
1147430609 17:40368279-40368301 TGGCAATGCAGATAAAAAACTGG - Intergenic
1148007708 17:44447482-44447504 AGGCAATCCCTAAAAAAGACTGG + Intronic
1150049845 17:61950816-61950838 TGGCAATACCTTAAGAAAAAGGG + Exonic
1150542016 17:66111583-66111605 TAGCAAACTATTAAAAACACAGG + Intronic
1151575267 17:74949972-74949994 ATGCAATCCATTAAACAAATAGG - Exonic
1151887152 17:76929826-76929848 TTGCAACCAATTAAAATAACAGG - Intronic
1155900564 18:31384195-31384217 TGGAAATGCATTGAAAACACAGG - Intronic
1157694616 18:49711151-49711173 TGGCAATCATTTAAAAAGTCAGG - Intergenic
1159478333 18:68953908-68953930 TAACATTACATTAAAAAAACAGG + Intronic
1159824457 18:73189513-73189535 TGCCAATCAATTAAAAAACTTGG + Intronic
1159978876 18:74752040-74752062 TGGCAATCATTTAAAAAGTCAGG - Intronic
1161355033 19:3814242-3814264 CAGCAATCCAATAAAAAAATTGG + Intronic
1164322886 19:24166582-24166604 TGGTAATCCAGCAAAGAAACAGG + Intergenic
1164323463 19:24171257-24171279 TGGTAATCCAACAAAGAAACAGG + Intergenic
1165602297 19:37064992-37065014 TGGTAATCCAACAAAGAAACAGG + Intronic
1165764038 19:38339096-38339118 TGGTAATCCAACAAAGAAACAGG + Intronic
1167418078 19:49387618-49387640 TGGCAATACATAAAAAGGACAGG + Intergenic
925414580 2:3660363-3660385 GGACAATTCATTAAAAAAAGGGG - Intronic
925432608 2:3808340-3808362 AAACAATCCATTAAACAAACAGG - Intronic
926893834 2:17662221-17662243 TGACACTCCATTCAAAATACTGG + Intergenic
927583377 2:24276145-24276167 AAGCAATCCATTAAAAATATGGG + Intronic
927905278 2:26850532-26850554 TTGCCATTCATTAAAAAAAAAGG + Intronic
928796227 2:35023562-35023584 TGGCAAACCAATTCAAAAACAGG + Intergenic
929677002 2:43945150-43945172 TGCCAATCCATTAAAACTAATGG + Intronic
930003815 2:46880558-46880580 AGGCAACCCAATAAATAAACTGG + Intergenic
930238762 2:48914035-48914057 TAGCAATCCAATATAAAAATAGG + Intergenic
930264231 2:49181194-49181216 TGGCAATCATTTAAAAAGTCAGG - Intergenic
931108605 2:59085377-59085399 TTGCAATTCTTTAAAAAAAAAGG - Intergenic
933019766 2:77175629-77175651 TGGTAATCCAACAAAGAAACAGG - Intronic
933615280 2:84477176-84477198 TGGTAATCCAACAAAGAAACAGG + Intergenic
936144687 2:109972596-109972618 TGGTAATCCAGCAAAGAAACAGG + Intergenic
936181372 2:110270559-110270581 TGGTAATCCAGCAAAGAAACAGG + Intergenic
936200000 2:110398873-110398895 TGGTAATCCAGCAAAGAAACAGG - Intergenic
937396409 2:121539780-121539802 AGGCAAGCCAGTAGAAAAACAGG + Intronic
937421559 2:121760528-121760550 TGGCAATACATTCAAAAAAAAGG - Intronic
937622587 2:124006150-124006172 TGGCAAGCCATCAAAAAAGGTGG - Intergenic
939023387 2:136984592-136984614 AGGCAATTTATTTAAAAAACAGG - Intronic
939084280 2:137698586-137698608 GGCCTATCCATTAAAAAAAGTGG - Intergenic
940320233 2:152369164-152369186 TGTCAAAACATTAAAAGAACTGG + Intronic
940810283 2:158235198-158235220 TGGCCAGACATTATAAAAACTGG - Intronic
941245041 2:163085836-163085858 TGGTAATCCAACAAAGAAACAGG - Intergenic
941327012 2:164128457-164128479 TTGCAAACCATTACAATAACTGG + Intergenic
941760880 2:169241651-169241673 TGGAAGTACATTAAAAACACAGG - Intronic
942465444 2:176203034-176203056 TGGCAATGCATTGAAAACATAGG + Intergenic
942874873 2:180783079-180783101 TGGCAATCATTTAAAAAGTCAGG - Intergenic
943140107 2:183971568-183971590 GGGCATTCAATTAGAAAAACAGG - Intergenic
943548443 2:189310230-189310252 TAACAATCCAATAAAAAAACCGG + Intergenic
944617141 2:201472778-201472800 AAGCAATCCAATTAAAAAACAGG - Intronic
945514567 2:210747095-210747117 TGGTAATCCAACAAAGAAACAGG - Intergenic
946764401 2:223026679-223026701 AGTCAAGACATTAAAAAAACTGG + Intergenic
946952704 2:224894804-224894826 TGGCAATCGAAGAAAAAGACAGG - Intronic
947214711 2:227739542-227739564 TGGTAATCCAACAAAGAAACCGG - Intergenic
947882132 2:233526022-233526044 TGGTAATCTATTAAGTAAACTGG - Intronic
948288649 2:236807808-236807830 TGGAAAACAATTTAAAAAACAGG + Intergenic
948592512 2:239060419-239060441 AGACAATCCAATAGAAAAACGGG + Intronic
1169566097 20:6855165-6855187 TGAGAATCTATTATAAAAACGGG - Intergenic
1170365981 20:15598781-15598803 TTGCCATCCAATAAAAATACAGG + Intronic
1170616332 20:17955269-17955291 TCACAATCCATTAAAAAAAGTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173304352 20:41834019-41834041 AGGCAGTCCATGAAAAAAAATGG - Intergenic
1177322853 21:19544819-19544841 TGGTAATCCAACAAAGAAACAGG - Intergenic
1179840445 21:44069341-44069363 TGACAAACCAGTAGAAAAACAGG + Intronic
1182131752 22:27858455-27858477 TGTCAATCCAACAAAAAAGCTGG + Exonic
1184753740 22:46504202-46504224 TGGCAATTCACAGAAAAAACAGG + Intronic
950598480 3:14008283-14008305 GGGTAATTCATTAAAAAAACAGG - Intronic
950777639 3:15364451-15364473 TGGTAATCCAACAAAGAAACAGG - Intergenic
951456379 3:22896606-22896628 TTGCAACACATTAAAAAAAAGGG - Intergenic
952025826 3:29080716-29080738 TAGCATTCAATTAAAAACACTGG - Intergenic
952109263 3:30103877-30103899 TGGTAATCCAACAAAGAAACAGG + Intergenic
952620810 3:35339427-35339449 TGGCAATAAATTCAAAAAACAGG + Intergenic
953647567 3:44769282-44769304 TGGCAATCCATCAAGAAAGAGGG + Intronic
954589132 3:51765191-51765213 TGGCAATAAATTAAACAAAATGG - Intergenic
955381835 3:58445140-58445162 TGGTAATCCAACAAAGAAACAGG - Intergenic
955536839 3:59932628-59932650 TCACAATCAATTAAGAAAACAGG + Intronic
956703462 3:71979440-71979462 TGCCAGTCCATTAAAAAACCCGG - Intergenic
957309505 3:78501294-78501316 GGGTAATCTATGAAAAAAACAGG - Intergenic
957824712 3:85425850-85425872 TGGTAATCCAACAAATAAACAGG + Intronic
957925719 3:86808578-86808600 TGCCAATAAATTAGAAAAACTGG + Intergenic
958012160 3:87893690-87893712 TTGCAATCCATGACAATAACTGG + Intergenic
959379885 3:105629162-105629184 TGGCAATGGATTAAAATAAGTGG - Intergenic
960821497 3:121737808-121737830 AGACAATCTATTAAAAAAACAGG - Intronic
961246136 3:125455420-125455442 TGGGCATCTATTAATAAAACAGG + Intronic
962592814 3:136907766-136907788 TATCAATTCATCAAAAAAACAGG - Intronic
963030745 3:140972785-140972807 AGACAATCCATTCATAAAACTGG + Intronic
963812753 3:149795531-149795553 TGGAAATACATTCAGAAAACTGG + Intronic
963975321 3:151473831-151473853 GGGGAAGCTATTAAAAAAACAGG - Intergenic
964039339 3:152240325-152240347 TGGCAATCGCATAAAAAAACAGG + Intergenic
964247979 3:154676257-154676279 TGGAATTCCAGGAAAAAAACGGG - Intergenic
964858734 3:161176194-161176216 TGGCAATGTCTTAAAAACACTGG + Intronic
964970179 3:162550888-162550910 TAGTAATCCAATTAAAAAACTGG - Intergenic
965098234 3:164262063-164262085 TGCCAAACAATAAAAAAAACTGG + Intergenic
965438551 3:168684314-168684336 TGACAATTCATTTAAAAATCGGG - Intergenic
965770066 3:172172597-172172619 TGGGAATCCAGCAAAAATACTGG + Intronic
965790493 3:172382139-172382161 TGGCAATCATTTAAAAAGTCAGG - Intronic
965825435 3:172724561-172724583 TGGTAATCCAACAAAGAAACAGG - Intergenic
965830465 3:172780875-172780897 AGACAATCCAATCAAAAAACAGG - Intronic
966311506 3:178599396-178599418 TGGCAAGCTACTAAAAAAGCAGG + Intronic
967308223 3:188080313-188080335 TAGCAATCCATGAAAAAATATGG + Intergenic
968257094 3:197285573-197285595 AGACAATCCAATAAAAAAATAGG + Intronic
970563961 4:17312691-17312713 TCAAAATCCTTTAAAAAAACAGG - Intergenic
971336995 4:25732479-25732501 TGGCAATGACTTAAAACAACTGG - Intergenic
971919554 4:32919626-32919648 TGAAAATACATTAAAACAACTGG + Intergenic
974277028 4:59735148-59735170 TAGCAATTCTTTAAAAAAATAGG - Intergenic
975179281 4:71325232-71325254 TTGGATTCCATTAAAAAAAAAGG + Intronic
975873465 4:78807909-78807931 TGGCAAACCATTAGCTAAACTGG - Intronic
976007292 4:80444996-80445018 TGGCGATCCATTAAAAAGTCAGG + Intronic
976647670 4:87402263-87402285 TGGTAATCCAACAAAGAAACAGG + Intergenic
976648338 4:87408545-87408567 TGGTAATCCAACAAAGAAACAGG + Intergenic
979451297 4:120873956-120873978 TGTCAATTAAATAAAAAAACTGG - Intronic
980537826 4:134152032-134152054 TGACAATCCATTAGAAAATTGGG - Intergenic
980563553 4:134508054-134508076 TAGAAATCCATTCAACAAACTGG + Intergenic
981456319 4:144957272-144957294 TGGCAATCATTTAAAAAGTCAGG - Intergenic
981907987 4:149944579-149944601 TGGCAATCATTTAAAAAGTCAGG - Intergenic
982683797 4:158463853-158463875 TGGCAATCATTAAAAAAATCAGG - Intronic
982953342 4:161728988-161729010 TGGAAATCCATCACAAAAGCAGG + Intronic
983448681 4:167884166-167884188 TAGCAATCTAGTATAAAAACAGG - Intergenic
984938326 4:184909246-184909268 TGGTAATCCAACAAAGAAACAGG + Intergenic
984938744 4:184912886-184912908 TGGTAATCCAACAAAGAAACAGG + Intergenic
985030404 4:185783550-185783572 AGTCAATCCATTAAACAAAAAGG + Intronic
986224775 5:5802382-5802404 TGAGAATCCATGAAAAAAAGAGG + Intergenic
986511579 5:8512659-8512681 TGGCACTCTATTAAGAAAAGAGG + Intergenic
987141234 5:14948743-14948765 AGGCCATCCAATAGAAAAACAGG - Intergenic
987876455 5:23687379-23687401 TGGTAATCCAACAAAGAAACAGG - Intergenic
988083152 5:26438420-26438442 TGACAATACATTAGAAAACCTGG + Intergenic
988250274 5:28748524-28748546 TGGTAATCCAACAAAGAAACAGG + Intergenic
988929475 5:36022431-36022453 TGGTAATCCAACAAAGAAACAGG + Intergenic
989014725 5:36917169-36917191 TGGCGATCCACTAAAAAGTCAGG - Intronic
989332420 5:40275459-40275481 TTGCAACCCATTACACAAACTGG + Intergenic
989799789 5:45523527-45523549 TGGCAATCATTTAAAAAGTCAGG - Intronic
990679001 5:58220067-58220089 GGGCATTCAATTACAAAAACAGG + Intergenic
991319889 5:65360890-65360912 TGGTAAACTATTAAAAAAATTGG - Intronic
991419978 5:66430798-66430820 TGGCAATCATTTAAATAAATTGG - Intergenic
991493625 5:67207398-67207420 TGACAATCCAAAAAAAAAAAAGG - Intergenic
992467080 5:77016716-77016738 TGGCCATCCTATAAAAAGACAGG + Intergenic
993161492 5:84297676-84297698 TGGTAATCCAACAAAGAAACAGG + Intronic
994548187 5:101197195-101197217 AAGCAATCCATTAGAAAAAAAGG + Intergenic
995116063 5:108481096-108481118 TGACAATATATTAAAAAATCTGG + Intergenic
995785496 5:115823235-115823257 TGGCAATCATTAAAAAAACCTGG - Intergenic
995801781 5:116004548-116004570 TGGCAAACAATGAACAAAACAGG - Intronic
996237749 5:121153297-121153319 TGGAAATGCATAAATAAAACAGG + Intergenic
996275866 5:121665369-121665391 TGGCAATCATTTAAAAAGTCAGG + Intergenic
996491540 5:124103941-124103963 AGGCATTTCATTAAAAATACTGG + Intergenic
996857141 5:128020920-128020942 TTCCAATCCATTACAAAAATTGG - Intergenic
997062516 5:130524162-130524184 TGGTATTCAATTAAGAAAACAGG + Intergenic
998316824 5:141190106-141190128 TGGCAAACCAATAAGAACACCGG - Exonic
998597131 5:143543772-143543794 TGGCATTCCATTAAAATGAGAGG + Intergenic
999425051 5:151480622-151480644 AGGCAATCTATTAGAAAAGCAGG - Intronic
1000158503 5:158575901-158575923 TGGTAATCCAATCAAAAAATGGG - Intergenic
1000850436 5:166333365-166333387 TGTCTCTCCAGTAAAAAAACAGG + Intergenic
1002361365 5:178673866-178673888 TGGTAATCCAACAAAGAAACAGG + Intergenic
1003732086 6:8836632-8836654 TAGGAATCCATTAAAAATATGGG + Intergenic
1004039470 6:11961472-11961494 CAGCAACCCATTGAAAAAACCGG + Intergenic
1006229683 6:32573498-32573520 TTGCAGTCCTTTAAAAAACCAGG - Intronic
1007258182 6:40543031-40543053 TGGCAAACCATTAAAGTGACTGG + Intronic
1007976820 6:46110214-46110236 TGGTAATCCAACAAAGAAACAGG - Intergenic
1009384386 6:63070946-63070968 TCGCAATCAATTAAAAAGTCAGG - Intergenic
1011307926 6:85949518-85949540 TCTCATTCCATTAAATAAACTGG + Intergenic
1011509336 6:88082652-88082674 GGGCAATTTATTAAAAAAAGAGG - Intergenic
1011653812 6:89531595-89531617 TGGCAGACCATTTAAAAAATTGG + Intronic
1012817205 6:104039252-104039274 TGGGAATCCAAAAAATAAACTGG - Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1013331820 6:109110208-109110230 TGGCAATCATTTAAAAAGTCAGG - Intronic
1014152796 6:118078057-118078079 TGAGAAGCCATTAAAAAAAAAGG - Intronic
1014813564 6:125911113-125911135 TGGTAATCCAACAAAGAAACAGG + Intronic
1014813750 6:125912561-125912583 TGGTAATCCAACAAAGAAACAGG + Intronic
1016575268 6:145563214-145563236 GGGCAAGCCAATAAGAAAACCGG - Intronic
1018025026 6:159798964-159798986 GGGGTATACATTAAAAAAACTGG - Intergenic
1018687813 6:166317472-166317494 TGGTAATCCAACAAAGAAACAGG - Intergenic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1019089827 6:169519346-169519368 TGGCAATTTATTAAGAAAAGAGG + Intronic
1020539344 7:9440554-9440576 GGGCATTCAATTAGAAAAACAGG + Intergenic
1020636452 7:10701329-10701351 TGGCAATCATTTAAAAAGTCAGG + Intergenic
1020654885 7:10917330-10917352 TGGCAATTCATTAAAGAGAATGG - Intergenic
1021414662 7:20368564-20368586 TGGCATTCAATTAGAAAAATAGG - Intronic
1021700082 7:23309874-23309896 TGCCATTCCATTAAACAAACAGG - Exonic
1022806854 7:33831076-33831098 TGCCAAAGCATTAACAAAACAGG - Intergenic
1023910615 7:44553140-44553162 TGGTAATCCAACAAAGAAACAGG - Intergenic
1024100341 7:46026142-46026164 TGGCAAACCTTTAACAAGACTGG - Intergenic
1027624952 7:80533320-80533342 TGGTAATCCAACAAAGAAACAGG + Intronic
1028019842 7:85756584-85756606 TGGCAATCATTAAAAAAATCAGG + Intergenic
1030064267 7:105647345-105647367 TGGAAATACATTTAAAAAACCGG + Intronic
1030157923 7:106475583-106475605 TGGCAAATCATTACAAAAAGTGG - Intergenic
1030904729 7:115168438-115168460 TGGCAATCATTTAAAAAGTCAGG - Intergenic
1030966062 7:115994669-115994691 TGGCAATCATTTAAAAAGTCAGG + Intronic
1030974885 7:116109547-116109569 TGGCAATCATTTAAAAAGTCAGG + Intronic
1032069201 7:128793263-128793285 TTTTAATGCATTAAAAAAACTGG - Intronic
1032143553 7:129357557-129357579 TGACAACCCAATAGAAAAACAGG + Intronic
1034261762 7:149761230-149761252 TGCCAACCCATTAAAAAGATTGG + Intergenic
1035197467 7:157234010-157234032 AGACAATCCAATAAAAAAATAGG - Intronic
1036192971 8:6688023-6688045 TGGCAATAAATGAAAAAAATAGG - Intergenic
1036277974 8:7372936-7372958 TGGCTGTCCAATAAAAAAAAAGG + Intronic
1036343549 8:7938956-7938978 TGGCTGTCCAATAAAAAAAAAGG - Intronic
1037354239 8:17999837-17999859 TGTGGATCCATTAAAAAAAAAGG - Intronic
1037791408 8:21945791-21945813 TGTCAATGCATTAAAAAAGGAGG - Intronic
1038873487 8:31521637-31521659 TGGCAAACAAATAAGAAAACTGG - Intergenic
1040983345 8:53268091-53268113 TGGCATTTCATCAACAAAACAGG - Intergenic
1041748611 8:61235342-61235364 TGGAAATGCTTTAAAAAAAGTGG + Intronic
1042724528 8:71859229-71859251 TGGCAATCCAATACTAAACCAGG - Intronic
1042982441 8:74545545-74545567 TGACAATACAGTAATAAAACTGG + Intergenic
1043142380 8:76605952-76605974 TGGCGATCCTTTTAAAATACAGG - Intergenic
1044313159 8:90718820-90718842 TGGCAATCAATTGAAAAGTCTGG + Intronic
1044576220 8:93772207-93772229 TGGCAAGCAATAAAAAAAATTGG - Intronic
1044864679 8:96558963-96558985 TGGCAATCCATGAAATAATCTGG - Intronic
1045220669 8:100196702-100196724 GCACAGTCCATTAAAAAAACTGG - Intronic
1045229536 8:100289482-100289504 AGACAATCCAATAGAAAAACGGG + Intronic
1045725234 8:105165117-105165139 TGGAAATAAATTGAAAAAACTGG - Intronic
1045905131 8:107336149-107336171 TGAAGATCCATGAAAAAAACAGG - Exonic
1045960933 8:107967045-107967067 TGGCAGTCAATGACAAAAACAGG + Intronic
1046314614 8:112483017-112483039 TGGAAACCTATTATAAAAACAGG - Intronic
1046967007 8:120178745-120178767 TGGCAATCTATTAAAAAGTCAGG - Intronic
1050079561 9:1902149-1902171 AAACAACCCATTAAAAAAACAGG + Intergenic
1050144853 9:2556220-2556242 TGGTAATCCAACAAAGAAACAGG + Intergenic
1051202973 9:14649840-14649862 GGGCAATCCAATAAGAGAACAGG + Intronic
1052282866 9:26752992-26753014 GGGCAATCTATTAAAAAAAGAGG - Intergenic
1052405795 9:28059273-28059295 TGGTAATCCAACAAAGAAACAGG - Intronic
1052529311 9:29659911-29659933 TGGTAATCCAACAAAGAAACAGG + Intergenic
1052538855 9:29780443-29780465 TGGTAATCCAACAAAGAAACAGG + Intergenic
1057070490 9:92095110-92095132 TGGGAATCCAGTAAAAAAACAGG + Intronic
1057115754 9:92519970-92519992 AGGCAATGCAATAAAAAAATGGG + Intronic
1057446838 9:95122391-95122413 TGGCCATCAGTTAAAAAGACAGG + Intronic
1058027587 9:100159086-100159108 GGGCAATTTATTTAAAAAACAGG - Intronic
1058119962 9:101127438-101127460 TGGTAATCCAACAAAGAAACAGG + Intronic
1059547827 9:115196589-115196611 TAGCAATACTTCAAAAAAACTGG - Intronic
1060020413 9:120125532-120125554 GGGTAATTTATTAAAAAAACAGG - Intergenic
1060574474 9:124677797-124677819 TGGCAAACTATAAAGAAAACAGG - Intronic
1186594014 X:10961018-10961040 TGGCAATCCACTAGAAAAGTAGG - Intergenic
1189650056 X:43178921-43178943 TGGCACTCCATAAGGAAAACAGG - Intergenic
1191061507 X:56302378-56302400 TGGCAGTCCACAAAAATAACAGG - Intergenic
1191114455 X:56837625-56837647 TGGCAATCAATTAGGAAAAGAGG - Intergenic
1192422265 X:71044258-71044280 GGTTAATCCATTAAATAAACTGG - Intergenic
1194034028 X:88848596-88848618 TGGTAATCCAACAAAGAAACAGG + Intergenic
1197481887 X:126996191-126996213 TGGAAAGCCATTAAAAAAAAAGG + Intergenic
1197555596 X:127948710-127948732 TGGTAATCCAGCAAAGAAACAGG - Intergenic
1198028690 X:132734235-132734257 TGGCACTTCATTAACAAAACGGG + Intronic
1201522437 Y:14890483-14890505 TGTTAATCTTTTAAAAAAACTGG + Intergenic
1201586993 Y:15572132-15572154 TGGCAATCATTAAAAAAATCAGG + Intergenic