ID: 919038986 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:192357411-192357433 |
Sequence | AGGGAGACACAGAAAGAGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4303 | |||
Summary | {0: 1, 1: 0, 2: 44, 3: 490, 4: 3768} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
919038979_919038986 | 26 | Left | 919038979 | 1:192357362-192357384 | CCACATTTTTATTCATTCCTTCT | 0: 1 1: 0 2: 10 3: 129 4: 1274 |
||
Right | 919038986 | 1:192357411-192357433 | AGGGAGACACAGAAAGAGGGAGG | 0: 1 1: 0 2: 44 3: 490 4: 3768 |
||||
919038980_919038986 | 9 | Left | 919038980 | 1:192357379-192357401 | CCTTCTTAAAGAGCTCTCCTTCA | 0: 1 1: 0 2: 1 3: 17 4: 179 |
||
Right | 919038986 | 1:192357411-192357433 | AGGGAGACACAGAAAGAGGGAGG | 0: 1 1: 0 2: 44 3: 490 4: 3768 |
||||
919038983_919038986 | -8 | Left | 919038983 | 1:192357396-192357418 | CCTTCAAAAGAAGAAAGGGAGAC | 0: 1 1: 0 2: 2 3: 39 4: 611 |
||
Right | 919038986 | 1:192357411-192357433 | AGGGAGACACAGAAAGAGGGAGG | 0: 1 1: 0 2: 44 3: 490 4: 3768 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
919038986 | Original CRISPR | AGGGAGACACAGAAAGAGGG AGG | Intronic | ||
Too many off-targets to display for this crispr |