ID: 919038986

View in Genome Browser
Species Human (GRCh38)
Location 1:192357411-192357433
Sequence AGGGAGACACAGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4303
Summary {0: 1, 1: 0, 2: 44, 3: 490, 4: 3768}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919038979_919038986 26 Left 919038979 1:192357362-192357384 CCACATTTTTATTCATTCCTTCT 0: 1
1: 0
2: 10
3: 129
4: 1274
Right 919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG 0: 1
1: 0
2: 44
3: 490
4: 3768
919038980_919038986 9 Left 919038980 1:192357379-192357401 CCTTCTTAAAGAGCTCTCCTTCA 0: 1
1: 0
2: 1
3: 17
4: 179
Right 919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG 0: 1
1: 0
2: 44
3: 490
4: 3768
919038983_919038986 -8 Left 919038983 1:192357396-192357418 CCTTCAAAAGAAGAAAGGGAGAC 0: 1
1: 0
2: 2
3: 39
4: 611
Right 919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG 0: 1
1: 0
2: 44
3: 490
4: 3768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919038986 Original CRISPR AGGGAGACACAGAAAGAGGG AGG Intronic
Too many off-targets to display for this crispr