ID: 919040232 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:192377867-192377889 |
Sequence | TGTTATGTGTAGCTTGTAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
919040232_919040236 | 29 | Left | 919040232 | 1:192377867-192377889 | CCCTCTACAAGCTACACATAACA | No data | ||
Right | 919040236 | 1:192377919-192377941 | AGAAATAGAACTTTTCTTTTTGG | No data | ||||
919040232_919040234 | -8 | Left | 919040232 | 1:192377867-192377889 | CCCTCTACAAGCTACACATAACA | No data | ||
Right | 919040234 | 1:192377882-192377904 | ACATAACAAATCAAGATTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
919040232 | Original CRISPR | TGTTATGTGTAGCTTGTAGA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |