ID: 919040232

View in Genome Browser
Species Human (GRCh38)
Location 1:192377867-192377889
Sequence TGTTATGTGTAGCTTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919040232_919040236 29 Left 919040232 1:192377867-192377889 CCCTCTACAAGCTACACATAACA No data
Right 919040236 1:192377919-192377941 AGAAATAGAACTTTTCTTTTTGG No data
919040232_919040234 -8 Left 919040232 1:192377867-192377889 CCCTCTACAAGCTACACATAACA No data
Right 919040234 1:192377882-192377904 ACATAACAAATCAAGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919040232 Original CRISPR TGTTATGTGTAGCTTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr