ID: 919042279

View in Genome Browser
Species Human (GRCh38)
Location 1:192405332-192405354
Sequence CTGTGACCCTTTAAGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919042279_919042281 11 Left 919042279 1:192405332-192405354 CCTTGGATCTTAAAGGGTCACAG No data
Right 919042281 1:192405366-192405388 CAACTTTCTAATCAAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919042279 Original CRISPR CTGTGACCCTTTAAGATCCA AGG (reversed) Intergenic
No off target data available for this crispr