ID: 919049004

View in Genome Browser
Species Human (GRCh38)
Location 1:192489261-192489283
Sequence GACCTAGAATTCCCCACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919049003_919049004 -2 Left 919049003 1:192489240-192489262 CCACTGAGAGCAGCAACTATGGA No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data
919049001_919049004 -1 Left 919049001 1:192489239-192489261 CCCACTGAGAGCAGCAACTATGG No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data
919049000_919049004 3 Left 919049000 1:192489235-192489257 CCATCCCACTGAGAGCAGCAACT No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data
919048997_919049004 24 Left 919048997 1:192489214-192489236 CCTAGTGATCCTGCTGGCCTGCC No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data
919048998_919049004 15 Left 919048998 1:192489223-192489245 CCTGCTGGCCTGCCATCCCACTG No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data
919048999_919049004 7 Left 919048999 1:192489231-192489253 CCTGCCATCCCACTGAGAGCAGC No data
Right 919049004 1:192489261-192489283 GACCTAGAATTCCCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919049004 Original CRISPR GACCTAGAATTCCCCACATC TGG Intergenic
No off target data available for this crispr