ID: 919049710

View in Genome Browser
Species Human (GRCh38)
Location 1:192499016-192499038
Sequence GGCCCCAGTGCAGGATCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919049710_919049715 -1 Left 919049710 1:192499016-192499038 CCAGTGGATCCTGCACTGGGGCC No data
Right 919049715 1:192499038-192499060 CACAGGTGAAGCTGCCTGCCGGG No data
919049710_919049716 0 Left 919049710 1:192499016-192499038 CCAGTGGATCCTGCACTGGGGCC No data
Right 919049716 1:192499039-192499061 ACAGGTGAAGCTGCCTGCCGGGG No data
919049710_919049717 7 Left 919049710 1:192499016-192499038 CCAGTGGATCCTGCACTGGGGCC No data
Right 919049717 1:192499046-192499068 AAGCTGCCTGCCGGGGCCACAGG No data
919049710_919049714 -2 Left 919049710 1:192499016-192499038 CCAGTGGATCCTGCACTGGGGCC No data
Right 919049714 1:192499037-192499059 CCACAGGTGAAGCTGCCTGCCGG No data
919049710_919049718 10 Left 919049710 1:192499016-192499038 CCAGTGGATCCTGCACTGGGGCC No data
Right 919049718 1:192499049-192499071 CTGCCTGCCGGGGCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919049710 Original CRISPR GGCCCCAGTGCAGGATCCAC TGG (reversed) Intergenic
No off target data available for this crispr